• PRO Courses Guides New Tech Help Pro Expert Videos About wikiHow Pro Upgrade Sign In
  • EDIT Edit this Article
  • EXPLORE Tech Help Pro About Us Random Article Quizzes Request a New Article Community Dashboard This Or That Game Popular Categories Arts and Entertainment Artwork Books Movies Computers and Electronics Computers Phone Skills Technology Hacks Health Men's Health Mental Health Women's Health Relationships Dating Love Relationship Issues Hobbies and Crafts Crafts Drawing Games Education & Communication Communication Skills Personal Development Studying Personal Care and Style Fashion Hair Care Personal Hygiene Youth Personal Care School Stuff Dating All Categories Arts and Entertainment Finance and Business Home and Garden Relationship Quizzes Cars & Other Vehicles Food and Entertaining Personal Care and Style Sports and Fitness Computers and Electronics Health Pets and Animals Travel Education & Communication Hobbies and Crafts Philosophy and Religion Work World Family Life Holidays and Traditions Relationships Youth
  • Browse Articles
  • Learn Something New
  • Quizzes Hot
  • This Or That Game
  • Train Your Brain
  • Explore More
  • Support wikiHow
  • About wikiHow
  • Log in / Sign up
  • Education and Communications

How to Perform a Titration

Last Updated: June 25, 2024 Fact Checked

This article was co-authored by Bess Ruff, MA . Bess Ruff is a Geography PhD student at Florida State University. She received her MA in Environmental Science and Management from the University of California, Santa Barbara in 2016. She has conducted survey work for marine spatial planning projects in the Caribbean and provided research support as a graduate fellow for the Sustainable Fisheries Group. There are 10 references cited in this article, which can be found at the bottom of the page. This article has been fact-checked, ensuring the accuracy of any cited facts and confirming the authority of its sources. This article has been viewed 465,384 times.

A titration is a technique used in chemistry to help determine the concentration of a reactant mixed within an unknown solution. The process involves adding a known solution to the unknown solution until a reaction occurs. Most often, this reaction is a color change. When done correctly and carefully, a titration will yield very precise results for acid-base calculations, redox reactions, complexation, and many other calculations.

Setting up Your Equipment

Step 1 Gather all the necessary equipment before starting.

  • Your analyte is the sample in which you are looking for a specific chemical quantity. That chemical is your titrand. For example, if you are checking the chloride levels in your local water supply, tap water would be your analyte, and the chlorides would be your titrand.
  • Your titrant is the chemical that you add to your analyte in measured quantities to help you calculate the amount of your titrand.
  • You want enough of your titrant that you can repeat your titration at least 3 times. If you are unsure of how much of your titrant you need, you can look online or consult your lab’s director.

Step 2 Rinse and purge your burette

  • Repeat the rinsing process at least 3 times with water to completely clean your burette.
  • After you’ve rinsed the burette with water, perform the same rinsing process at least 2 times with your analyte.

Step 3 Clean and rinse all glassware.

  • If you do not have deionized water, available, tap water will work. However, the distilled water rinse will still be necessary as this lowers the chances of contamination for your analyte.

Step 4 Fill the burette with an excess amount of titrant.

  • If you overfill your burette, open the stopcock slightly and let the excess titrant flow out until it reaches the zero mark.

Step 5 Clamp the burette carefully to a burette stand.

Conducting Your Titration

Step 1 Measure out a precise amount of analyte in a clean beaker or flask.

  • If necessary, rinse the analyte into your beaker or flask, thus making sure all of the analyte is in the beaker.
  • The amount of analyte you need will depend on your experimental design, the types of chemicals, and the titrand you’re trying to find.

Step 2 Drop a small amount of color indicator into the beaker.

  • Likewise, the amount of color indicator you need will depend on the volume of your analyte. Generally, you will need between 3-5 drops of indicator for 100 mL of analyte.

Step 3 Add your second chemical, if necessary.

  • As with the color indicator, the amount and type of buffer you may need depends on your quantity of analyte and the titrant for which you’re looking. Generally, though, you will add your buffer until it removes the tint imparted by the color indicator.
  • Generally, the buffer solution will be an acid or alkali in a specific, known concentration.

Step 4 Agitate the beaker using a magnetic stir plate.

  • You will leave the stir plate on until your titration is complete.
  • If you do not have a magnetic stir plate, you can agitate the beaker by hand by gently swirling it 4-5 times before placing it under the burette.

Step 5 Place the beaker under the burette.

  • If you notice a color change, close the stopcock and allow the agitator to run for 30 seconds. If the color dissipates before the 30-second mark, open the stopcock slightly and continue to add the titrant drop by drop until you get a permanent change. [13] X Research source
  • If you’re not using a magnetic stir plate, close the stopcock once you notice the first flash of color change. Agitate the beaker to see if the color dissipates. If it does, replace the beaker under the burette and continue the titration. If it does not, you’ve reached your endpoint.

Step 7 Record your final volume from your burette.

  • When reading the end volume of your burette, make sure your eyes are at the level of the titrant meniscus. Take your reading from the meniscus.

Finishing Your Analysis

Step 1 Dispose of the chemicals used in a labeled waste container.

  • For your burette, fill it with water, open the stopcock, and allow it to drain completely. Repeat this 2-3 times to rinse out the burette. [16] X Research source

Step 3 Calculate the concentration of the titrand.

  • Calculations of the concentration should be done to the appropriate number of significant figures. Ask your instructor or lab director if you’re unsure of what these may be.

Anne Schmidt

Anne Schmidt

Titration labs culminate chemistry learning. Titration labs are a favorite because they bring together so many concepts. Students get to apply claim, evidence, reasoning in experiments with engaging, colorful results. It's a culmination of chemistry learning in action.

Community Q&A

wikiHow Staff Editor

  • Always wear protective goggles and gloves and have emergency equipment on hand when you are performing any titration. Thanks Helpful 1 Not Helpful 0
  • The endpoint is extremely easy to overshoot if you're not observant. When you have the slightest feeling you're approaching endpoint, start counting drops, and go extremely slowly. Thanks Helpful 1 Not Helpful 0
  • In some cases, it may be easier to determine if the endpoint has been reached if you place a white card underneath your beaker or flask so that you can see if the indicator has changed color. Thanks Helpful 1 Not Helpful 0

method for titration experiment

  • Do not consume any of the reactants. Thanks Helpful 26 Not Helpful 6
  • Don't rinse any of the chemicals down the sink; put into an appropriate, labeled waste container. Thanks Helpful 20 Not Helpful 8

Things You'll Need

  • An excess amount of titrant
  • A precisely measured amount of analyte
  • A calibrated burette
  • A burette stand
  • A beaker or Erlenmeyer flask
  • Protective gloves
  • Safety goggles

You Might Also Like

Balance Chemical Equations

  • ↑ https://sciencing.com/purpose-titration-5406434.html
  • ↑ https://chemed.chem.purdue.edu/genchem/lab/equipment/buret/use.html
  • ↑ https://sciencing.com/must-appropriate-solution-before-titration-8745281.html
  • ↑ https://www.bbc.co.uk/bitesize/guides/zsbxjty/revision/2
  • ↑ http://www.digipac.ca/chemical/mtom/contents/chapter4/titration.htm
  • ↑ https://chemed.chem.purdue.edu/genchem/lab/techniques/titration/perform.html
  • ↑ http://www.bbc.co.uk/schools/gcsebitesize/science/add_ocr_pre_2011/chemical_synthesis/calculationsrev3.shtml
  • ↑ http://dept.harpercollege.edu/chemistry/chm/100/dgodambe/thedisk/labtech/titrate2.htm
  • ↑ https://www.txst.edu/chemistry/student-resources/Stockroom/cleaning-laboratory-glassware.html
  • ↑ https://sciencing.com/calculate-titration-5328453.html

About This Article

Bess Ruff, MA

To perform a titration, you'll need a calibrated burette, a burette stand, multiple beakers or Erlenmeyer flasks, a measured amount of your analyte, and a large quantity of your titrant. To start off, drop a small amount of color indicator into your beaker of analyte. Then, agitate the beaker using a magnetic plate or by swirling it 4-5 times so the solution is fully mixed. Once your solution is ready, place it under the burette and open the stopcock. You should let the titrant drop into the analyte until the beaker solution changes color. Close the stopcock immediately and wait for 30 seconds. If the color remains, note down your results. Or, if it fades, open the stopcock again and wait until you have a permanent color. For more tips from our Science co-author, including how to setup and clean your equipment, read on! Did this summary help you? Yes No

  • Send fan mail to authors

Reader Success Stories

Samvrtha Subramanian Sreenivasan

Samvrtha Subramanian Sreenivasan

Sep 5, 2022

Did this article help you?

Ayomide Emmanuel

Ayomide Emmanuel

Oct 10, 2018

Noor Ul Ain

Noor Ul Ain

Nov 13, 2018

Jessica Jackson

Jessica Jackson

Jun 16, 2016

Mallika Gupta

Mallika Gupta

Aug 31, 2016

Am I Smart Quiz

Featured Articles

Make Chicken Nuggets

Trending Articles

How to Do Fourth of July Nails: 40+ Nail Art Ideas

Lesson Explainer: Titration Experiments Chemistry • Third Year of Secondary School

In this explainer, we will learn how to describe acid–base titration methods and their use in determining acid and base concentrations.

When we want to determine the concentration of an acid or a base, we can perform a titration experiment. In a titration experiment, a solution with a known concentration is added to an exact volume of a solution with an unknown concentration in the presence of an indicator.

The apparatus necessary for the experiment is shown below.

A buret is used in this experiment because we are unsure of exactly what volume of a solution with a known concentration will be necessary. The stopcock or faucet at the bottom of the buret allows us to easily add a little amount of solution at a time. An Erlenmeyer flask, also known as a conical flask, is used because the flask can easily be swirled without spilling. Notice that the buret and Erlenmeyer flask are placed over the base of the retort stand to prevent the apparatus from toppling over. The white tile is optional but can help us to more easily identify subtle color changes.

A standard solution, also called a titrant, will be placed in the buret. A standard solution is a solution that has a known concentration.

Definition: Standard Solution (Titrant)

It is a solution with a known concentration.

If the solution that we are trying to determine the concentration of is an acid, the standard solution should be a base and vice versa. Standard solutions can be purchased but are often easily made in the laboratory.

How To: Making a Standard Solution from a Solid Solute

  • Use a small amount of water to rinse any remaining solute on the weigh boat or weight paper into the flask.
  • Stopper the flask and invert several times to mix thoroughly.

How To: Making a Standard Solution from a Liquid Solute

Titration experiments are often performed four or more times, so enough standard solution must be prepared to account for all of the trials.

Example 1: Recalling the Meaning of the Term Standard Solution

When undertaking a titration, the solution in the buret is usually a standard solution of acid or base. What does the term standard solution refer to?

A titration experiment is performed when we wish to determine the concentration of an acid or a base. During a titration, a solution with a known concentration is added to an exact volume of a solution with an unknown concentration in the presence of an indicator. The solution with an accurately known concentration is called a standard solution. The term standard solution refers to an acid or base of a known concentration.

When adding a standard solution to the buret, it is important to ensure that the stopcock at the bottom of the buret is in the closed position, perpendicular to the column.

A buret should always be filled at eye level to prevent spilling corrosive acids or bases into your face or eyes. A funnel can be placed into the top of the buret to further help prevent spillage when filling. To fill the buret, we slowly add titrant, filling to near the 0 mL mark. Then, we remove the funnel. It is not necessary to begin a titration at exactly 0.00 mL .

We should then check the buret for air bubbles, gently tapping to remove them. Next, we place a waste container under the buret and open the stopcock to allow a few milliliters of liquid to drain. We should use a wash bottle to rinse the tip of the buret with deionized water. We can then record the starting volume of titrant. We must remember to read the volume from the bottom of the meniscus.

Example 2: Understanding the Risks Associated with Filling a Buret

Why should a buret always be filled at eye level and never above?

  • To reduce the risk of splashing acid or base onto the eyes or face
  • To know when the beaker or measuring cylinder is empty
  • To make sure the solution is poured into the buret and not on the floor
  • To watch the solution move down the buret
  • To allow the buret to be filled while sitting down

A buret is frequently used when performing an acid–base titration and is therefore often filled with an acid or base. Acids and bases are corrosive. They can irritate or burn the eyes and skin and can cause respiratory distress. To minimize the potential for spilling such substances on the eyes or face, a buret should never be filled above eye level. The correct answer is choice A.

The solution of unknown concentration is called the titrand or analyte.

Definition: Titrand (Analyte)

It is a solution with an unknown concentration.

An exact volume of titrand should be added to an Erlenmeyer flask using a volumetric pipet. The volume of titrand used is sometimes called an aliquot.

Definition: Aliquot

It is a known volume of solution.

Example 3: Choosing Which Solution to Place into an Erlenmeyer Flask and Buret in an Acid–Base Titration

A student wants to use titration to determine how much acid is needed to neutralize a known volume of base. They set up the experiment as shown. At the start of the experiment, which solution should go into the Erlenmeyer flask and which should be used to fill the buret?

The Erlenmeyer flask is filled using a pipet. A pipet is a piece of glassware used to deliver a specific volume of liquid. A buret is a piece of glassware that is filled with a liquid that can then be dispensed. Burets are used when the volume of liquid necessary is not known as the stopcock at the bottom of the buret can easily be opened or closed to control the volume of the liquid delivered.

In this titration experiment, a student is using a known volume of base but does not know the total volume of acid needed. Therefore, the base should go into the Erlenmeyer flask and the acid into the buret.

During a titration experiment, the titrant will be added to the titrand until the acid and base have completely neutralized one another. This is called the equivalence point.

Definition: Equivalence Point

It is the point at which an acid and base have completely neutralized one another.

The approximate volume of titrant needed to reach the equivalence point can be visually determined by adding an acid–base indicator to the Erlenmeyer flask. An indicator is a weak acid or base that undergoes a color change over a specific pH range.

Definition: Indicator

It is a weak acid or base that undergoes a color change over a specific pH range.

There are a variety of indicators that can be chosen for a titration experiment depending on the acid and base used as the titrant and titrand. Near the equivalence point, addition of a single drop of titrant will cause the pH of the solution in the Erlenmeyer flask to change drastically. A good acid–base indicator will exhibit an abrupt color change during this point in the experiment.

The equivalence point of the reaction between a strong acid and strong base will occur at a pH of 7. However, a drastic pH change with the addition of single drops of titrant will occur between a pH of approximately 3.5 and 10.5. Therefore, we should choose an indicator that changes color within this range.

There are two indicators that are commonly used for strong acid–strong base titrations. They are phenolphthalein and methyl orange. We commonly say that phenolphthalein is colorless in acid and pink in base; although technically, this color change occurs between a pH of 8.2 and 10. We commonly say that methyl orange is red in acid and yellow in base; although technically, this color change occurs between a pH of 3.2 and 4.4.

A universal indicator is commonly found in the chemistry laboratory and is often used to test a solution to determine an approximate pH.

However, the universal indicator is not used in titrations because it changes color over a wide range of pH values and the color changes are less abrupt than other indicators.

Example 4: Determining the Color of an Indicator at One pH Value and Which Indicator to Use When the pH Changes from 8 to 11

The table below shows the color range for several different indicators.

  • Which indicator is blue at a pH of 5?
  • Which indicator would be best to show that the pH of a solution has changed from 8 to 11?

The graph shows the pH range in which each indicator changes color. For example, bromophenol blue changes color from yellow to blue between a pH of 3 and 4.6. Below a pH of 3, bromophenol blue will be yellow and above a pH of 4.6 bromophenol blue will be blue.

At a pH of 5, bromophenol blue will be blue, bromothymol blue will be yellow, cresolphthalein will be colorless, and alizarine yellow will be yellow. The indicator that is blue at a pH of 5 is bromophenol blue.

The indicator that would be best to show that the pH of a solution has changed from 8 to 11 will be an indicator that undergoes a color change in this pH range. Bromophenol blue and bromothymol blue will both remain blue as the pH changes from 8 to 11. Alizarine yellow will be yellow between a pH of 8 and 10 and will begin to turn orange as the pH gets closer to 11. There is color change; however, it occurs at too high of a pH. Cresolphthalein is colorless at a pH of 8 and purple at a pH of 10. As cresolphthalein undergoes a drastic color change in the desired pH range, it would be the best indicator to use for this experiment.

Let us consider a titration experiment where a base titrant, acid titrand, and phenolphthalein indicator are used. At the start of the experiment, phenolphthalein and the acid titrand will be in the Erlenmeyer flask. As phenolphthalein is colorless in acid, the flask will appear colorless.

When the base titrant is added, a bright-pink spot will appear in the Erlenmeyer flask as the phenolphthalein reacts with the base and turns pink. However, the color will quickly disappear as the acid titrand in the flask reacts with the base, neutralizing it. It is important to continue to swirl the flask, to allow the acid and base to react completely during this process.

As more base is added to the flask, the pink color will remain for longer periods of time. This is because as the experiment progresses, there is less acid in the solution and the acid–base neutralization reaction takes longer to occur. Once all of the acid has been neutralized, any additional base added will remain in the solution and can react with the phenolphthalein. When adding a drop of base causes the solution to turn faintly pink, the end point of the experiment has been reached.

Definition: End Point

It is the point in a titration experiment where the indicator has just changed color without reverting.

It is important to recognize that the end point of the experiment and the equivalence point are often not the same. The equivalence point occurs when all of the acid and base have been neutralized, but the end point occurs when the indicator has changed color.

The final volume of titrant in the buret should be recorded when the end point has been reached. If the Erlenmeyer flask appears a dark-pink color, too much base has been added and the experiment will need to be repeated.

The table below shows the desired end point for the phenolphthalein indicator and methyl orange indicator.

Example 5: Recalling the Colors of Methyl Orange

Fill in the blanks: Methyl orange is a useful indicator, particularly for titrations against acids. It is in strongly acidic solutions and in basic solutions.

Methyl orange is an indicator that is red in a solution with a pH less than 3.1 and yellow in a solution with a pH greater than 4.4. Solutions are acidic when the pH is less than 7, neutral when the pH is equal to 7, and basic when the pH is greater than 7.

This means that methyl orange will appear yellow in all basic solutions and red in strongly acidic solutions. We should fill in the first blank with the word red and the second blank with the word yellow.

It is very easy to add too much titrant during a titration. We can get an estimate of the amount of titrant needed to reach the end point by first performing a rough titration.

How To: Performing a Rough Titration

  • Properly fill a buret with titrant.
  • Record the initial volume of titrant in the buret.
  • Use a pipet to transfer an exact volume of titrand to an Erlenmeyer flask.
  • Add a few drops of the desired indicator to the Erlenmeyer flask and swirl.
  • Place the Erlenmeyer flask under the tip of the buret.
  • Open the stopcock of the buret to allow the titrant to quickly enter the flask, and swirl the flask continuously.
  • When the Erlenmeyer flask has undergone a permanent color change, close the stopcock.
  • Record the final volume of the titrant in the buret.
  • Subtract the initial volume of titrant from the final volume of titrant to determine the volume of titrant used in the titration.

Subtracting five milliliters from the volume of titrant used in a rough titration tells us how much titrant we can safely add quickly during a good titration. Never use the rough titration titrant volume in any titration calculations.

How To: Performing a Good Titration

  • Open the stopcock of the buret, add five milliliters less of titrant than was used during a rough titration. Close the stopcock.
  • Open the stopcock partway, allow the slow addition of titrant to the flask, swirling continuously.
  • When flashes of a different color (change in the indicator color) begin to appear in the flask, adjust the stopcock to allow only one drop to flow at a time.
  • Continue adding one drop of titrant at a time and swirling until the indicator color change takes longer to fade. At this point, close the stopcock.
  • Rinse the tip of the buret with deionized water into the flask and swirl.
  • If the color change remains, the end point has been reached and the final volume should be recorded.
  • If the color change does not remain, repeat adding a single drop of titrant, rinsing the tip of the buret, and swirling until the color change persists.
  • Record the final volume of titrant in the buret.
  • Repeat the entire titration two or three more times and average the volumes of the titrant used.

There are several common errors that can occur when performing a titration experiment. Measurement errors include inaccurate measurement of the titrand or misreading the initial or final buret volumes. Air bubbles in the buret will affect the volume readings as well. We can remove air bubbles by gently tapping the buret. In addition, if extra unreacted titrant is on the buret tip or in the neck of the flask, we can record a titrant volume that is too large. We can eliminate this error by rinsing the tip of the buret and the neck of the flask with deionized water when we are close to the end point of the titration.

If the indicator never changes color during the titration, the wrong indicator may have been selected or the same solution may have been placed in both the buret and Erlenmeyer flask. If the Erlenmeyer flask remains colorless during a titration involving phenolphthalein, double-check that the indicator was added to the flask.

  • An acid–base titration experiment is used to determine the concentration of a solution.
  • A standard solution or titrant is placed in the buret.
  • An aliquot of titrand or analyte is placed in the Erlenmeyer flask.
  • Indicators are added to the flask to signify the end point.
  • A phenolphthalein indicator is colorless in an acid and pink in a base, while a methyl orange indicator is red in a strong acid and yellow in a base.
  • When nearing the end point of a titration, a titrant should be added dropwise just until the indicator has changed color.

Join Nagwa Classes

Attend live sessions on Nagwa Classes to boost your learning with guidance and advice from an expert teacher!

  • Interactive Sessions
  • Chat & Messaging
  • Realistic Exam Questions

method for titration experiment

Nagwa uses cookies to ensure you get the best experience on our website. Learn more about our Privacy Policy

If you're seeing this message, it means we're having trouble loading external resources on our website.

If you're behind a web filter, please make sure that the domains *.kastatic.org and *.kasandbox.org are unblocked.

To log in and use all the features of Khan Academy, please enable JavaScript in your browser.

AP®︎/College Chemistry

Course: ap®︎/college chemistry   >   unit 4, acid–base titrations.

  • Worked example: Determining solute concentration by acid–base titration
  • Redox titrations
  • Introduction to titration

method for titration experiment

Want to join the conversation?

  • Upvote Button navigates to signup page
  • Downvote Button navigates to signup page
  • Flag Button navigates to signup page

Good Answer

Video transcript

ReAgent Chemical Services Limited

  • Pure Chemicals
  • Standard Solutions
  • Deionised Water
  • Distilled Water
  • Ultrapure Water
  • Absolute Ethanol
  • Demineralised Water
  • Propan-2-ol/Isopropanol
  • Why Buy From ReAgent?
  • Good Manufacturing Practice
  • Investors In People (IIP)
  • ISO 9001:2015 Accreditation
  • ISO 13485:2016 Accreditation
  • ISO 14001:2015 Accreditation
  • ISO 45001: 2018 Accreditation
  • Living Wage & Living Hours
  • Our Memberships
  • Our Customers
  • Environment Policy
  • Quality Policy
  • Smoke Free Policy
  • Production Facilities
  • Bespoke Chemical Services

How To Carry Out a Titration Experiment

  • The Chemistry Blog
  • Posted on October 13, 2021
  • by Lucy Bell-Young

A titration experiment is the gradual adding of a known concentration of a reagent , called a titrant , to an unknown concentration of an analyte (the substance being analysed) until an endpoint is reached. Titration is one of the classic experiments in chemistry, and it’s done by most students at school. 

Usually, chemical indicators that change colour are used to determine the endpoint of a titration experiment. However, depending on the type of substances to be titrated, an indicator may not be necessary. In some cases, the analyte acts as an indicator.

In this post:

What is a Titration Experiment?

A titration experiment can be done using various methods, depending on the chemicals being analysed, the purpose, and the scale. Many different industries have specific titration methods for specific chemicals and processes. Nonetheless, the fundamental principles involved stay the same.

A titration experiment is a simple and inexpensive means of determining the concentration of a solution that’s being analysed. It doesn’t require a complicated apparatus, only a graduated burette with a stopcock, a metal support stand, a burette clamp, a funnel, a flask or beaker, and an indicator. This basic setup applies for both school chemistry experiments and large industrial laboratories.

To carry out the experiment, you simply need a sample of a known solution, an unknown concentration and subject it to the titration process. For example, if you have a large batch of vegetable oil that your factory needs to process into biofuel, you may need to adjust the concentration of the lye (alkali) to properly convert it. In this case, you wouldn’t need to have cubic metres of samples to test its concentration. Instead, you’d only need to get a few litres or even milliliters of samples to be titrated.

Soap manufacturing is another sector that uses titration experiments to gain precise calculations of the ingredients needed for mass-producing various types of soaps. Determining the saponification number is essential when calculating how much lye is necessary. This number is the amount of base needed to hydrolyse a specific amount of fat to produce free fatty acids in a soap mixture.

Experimentally determining the saponification number is necessary because not all fat and oil raw materials have the same exact saponification number. Therefore, the amount of base in the solution must be adjusted accordingly.

5 Erlenmeyer flasks lined up on laboratory desk, each with different coloured solutions inside

What is the Aim of a Titration Experiment?

All titration experiments, regardless of the type, chemicals involved, complexity, or scale, have one main purpose: to determine the concentration of the analyte. This is achieved through the gradual addition of the titrant (which has a known concentration) and carefully measuring its volume until an endpoint is reached.

Going back to the saponification example, you can use the result of a titration experiment to determine the concentration of base needed to hydrolyse the fatty acids. It’s just a matter of proportion, and knowing both the volume and concentration of one solution (the titrant). Knowing the volume of another solution of unknown concentration will allow you to plug the numbers and make some calculations.

Remember that molarity of a solution can be calculated by dividing the moles or molar value of the solute by the litres of solution. Therefore, by rearranging our formula, the moles of a solute are equal to the molarity of a solution multiplied by the volume in litres:

moles of solute = M x V

This formula is very useful once you plug in the results of a titration experiment. You can easily calculate the molarity or concentration of the analyte. In an acid-base titration experiment, for instance, we can write the molarity formula for the balanced or endpoint reaction between acids and bases as:

M (a) x V (a) = M (b) x V (b)

The subscript (a) represents acid while the subscript (b) represents base.

How To Do a Redox Titration

Redox titration is just one of the four main types of titration experiments . The other types are acid-base, precipitation, and complexometric titrations. As the name implies, redox titration involves the reaction between a reducing and an oxidising agent.

Many of us are very familiar with acid-base titrations that involve the reactions between acids and bases. The key point to remember in this type of reaction is that hydrogen ions are transferred between the reactants. In comparison, redox titrations involve the change of the oxidation number of at least one element as electrons are transferred.

Some of the most common redox titrations are:

  • Permanganate titrations
  • Dichromate titrations
  • Iodimetric and iodometric titrations

The exact steps of redox titrations vary depending on the substances involved. However, there are some general stages you can follow:

  • You must write down the half balanced equation for the reduction side and another half balanced equation for the oxidation side
  • You then add the two equations together to have a redox reaction equation
  • Perform the experiment to collect data. Many redox titration experiments require indicators, but some do not
  • Once you have collected the data, you can now calculate the mole ratios of the reactants

Diagram showing the different stages of a titration experiment

How To Do a Back Titration

Back titration is a reverse titration. It involves the addition of excess titrant to a standard molar concentration to an analyte. In this experiment, the excess is titrated instead of the original sample. 

This method works well when the endpoint of the reverse titration can be easily identified, like in precipitation titrations. Back titrations are also good if the reactions between the titrant and the analytes are slow, or when the analyte is insoluble in water.

How To Do a Back Titration Calculation

Adding an excess titrant to an analyte then titrating the new solution will indirectly determine the original concentration of the analyte. It will take a two-part calculation to determine the original concentration of the analyte. This example from Socratic shows you the basic steps and calculations for a back titration:

Problem: 50.00 mL of 0.1000 mol/L HCl is added to 25.00 mL of a commercial ammonia-based cleaner. It required 21.50 mL of 0.1000 mol/L NaOH to neutralise the excess hydrochloric acid. 

What is the original concentration of ammonia in the cleaner?

Solution: We must assume that some HCl was neutralised when added in the ammonia solution . However, since the acid concentration is excessive, the new solution is acidic and needs to be neutralised using sodium hydroxide.

Part 1 – Calculations for the acid

  • Calculate the moles of HCl added to the solution. Based on the given concentrations in mL, we can then convert it to L and get the corresponding concentration of 0.005 mol
  • Calculate the moles of sodium hydroxide used. Again, through simple conversions, we get 0.00215 mol NaOH
  • Calculate the mole of excess HCl. Similarly, we get 0.00215 mol HCL
  • Calculate how much moles of HCL reacted with ammonia. You simply need to subtract the moles of the acid from the moles of ammonia: 0.00500 mol – 0.00215 mol = 0.002850 mol

Part 2 – Calculations for the ammonia

  • Calculate the moles of ammonia. You need to convert it to the right unit, which is 0.002 850 mol NH 3
  • Calculate the molarity of ammonia

How To Do a Titration Write Up

Just like other types of scientific reports that are required from you by your teacher or employer, you need to be brief, to the point, precise, and data-driven when writing about a titration experiment . The statement of the problem must be clear. 

You must have an introduction that explains the experiment and why you chose that method. Be clear about your methodology and instruments. Explain how you prepared the solutions. More importantly, focus on data presentation, describing the reactions, and the measurements that you’ve made.

The blog on chemicals.co.uk and everything published on it is provided as an information resource only. The blog, its authors and affiliates accept no responsibility for any accident, injury or damage caused in part or directly from following the information provided on this website. We do not recommend using any chemical without first consulting the  Material Safety Data Sheet  which can be obtained from the manufacturer and following the safety advice and precautions on the product label. If you are in any doubt about health and safety issues please consult the Health & Safety Executive ( HSE ).

How can ReAgent help you?

  • By using this form you agree with the storage and handling of your data by this website.

Customer Service

  • Top Navigation

ReAgent Chemical Services

  • Information
  • Specification
  • Hazards & Safety
  • w ogóle na komórkach przy wąskim wyświetlaczu to z reklamami kiepsko wygląda
  • Basic terms
  • Titration end point
  • End point indicators
  • End point detection
  • Equivalence point calculation
  • Titration curve calculation
  • Titration calculation
  • Back titration
  • Sample & titrant volume
  • Volumetric glassware
  • Volumetric glass cleaning
  • Glassware calibration
  • Standard substances
  • Sources of errors
  • End point (pH) indicators
  • Indicators preparation
  • Polyprotics and mixtures
  • Solutions used
  • Solutions standardization
  • HCl determination
  • H 2 SO 4 determination
  • Acetic acid in vinegar
  • H 3 PO 4 determination
  • NaOH determination
  • NaOH & Na 2 CO 3 assay
  • Potentiometric titrations
  • Permanganate titration
  • Precipitation
  • Argentometry
  • Solution standardization
  • Chlorides - Mohr method
  • Chlorides - Volhard method
  • Complexometric
  • EDTA titration overview
  • EDTA standardization
  • magnesium titration
  • calcium titration
  • zinc titration
  • nickel titration
  • aluminum titration
  • total water hardness
  • Further reading
  • » Acid-base titration
  • » Hydrochloric acid titration

Titration of hydrochloric acid with sodium hydroxide

General remarks.

Determination of hydrochloric acid concentration is probably the most often discussed example of acid-base titration. Both acid and base are strong, which not only makes determination of end point easy (steep part of the curve is long), but also means that calculation of titration curve and equivalence point are pretty straightforward.

This is a simple neutralization reaction:

HCl + NaOH → NaCl + H 2 O

It is worth of noting, that - as we can assume both acid and base to be completely dissociated - net ionic reaction is just

H + + OH - → H 2 O

which is the simplest form of neutralization reaction possible.

In the reality every acid and every base - no matter how strong - have some dissociation equilibria described by dissociation constant. In this particular case K a for HCl is listed as 10 4 (which means it can be safely neglected) and dissociation constant K b for NaOH is listed as 0.6 - which means sometimes it has to be taken into account.

sample size

Depending on the titrant concentration (0.2 M or 0.1 M), and assuming 50 mL burette, aliquot taken for titration should contain about 0.26-0.33 g (0.13-0.16 g) of hydrochloric acid (7-9 or 3.5-4.5 millimoles).

end point detection

Equivalence point of strong acid titration is usually listed as exactly 7.00. That's not necesarilly the case, as it depends on the solution temperature and ionic strength of the solution, besides, slight hydrolysis of NaOH shifts pH down by about 0.02 unit. Not that it changes much - we are still very close to 7. Thus the best indicator of those listed on pH indicators preparation page is bromothymol blue . However, as we have discussed on the acid-base titration end point detection page, unless we are dealing with a diluted solution (in the range of 0.001 M) we can use almost any indicator that gives observable color change in the pH 4-10 range. Thus we can safely use the most popular phenolphthalein and titrate to the first visible color change.

Color change of phenolphthalein during titration - on the left, colorless solution before end point, on the right - pink solution after end point. Note we have to end titration at first sight of color change, before color gets saturated.

solutions used

To perform titration we will need titrant - 0.2 M or 0.1 M sodium hydroxide solution , indicator - phenolphthalein solution and some amount of distilled water to dilute hydrochloric acid sample.

  • Pipette aliquot of hydrochloric acid solution into 250mL Erlenmeyer flask.
  • Dilute with distilled water to about 100 mL.
  • Add 2-3 drops of phenolphthalein solution.
  • Titrate with NaOH solution till the first color change.

result calculation

According to the reaction equation

Hydrochloric acid reacts with sodium hydroxide on the 1:1 basis. That makes calculation especially easy - when we calculate number of moles of NaOH used it will be already number of moles of HCl titrated.

To calculate hydrochloric acid solution concentration use EBAS - stoichiometry calculator . Download determination of hydrochloric acid concentration reaction file, open it with the free trial version of the stoichiometry calculator .

Click n=CV button above NaOH in the input frame, enter volume and concentration of the titrant used. Click Use button. Read number of moles and mass of hydrochloric acid in the titrated sample in the output frame. Click n=CV button in the output frame below hydrochloric acid, enter volume of the pipetted sample, read hydrochloric acid concentration.

sources of errors

Apart from general sources of titration errors , when titrating hydrochloric acid we should pay special attention to titrant. Sodium hydroxide solutions are not stable as they tend to absorb atmospheric carbon dioxide. Hydrochloric acid is much stronger than carbonic acid, so it will slowly expel carbon dioxide from the solution, but initially presence of carbonates will mean that to reach end point we need to add axcess of titrant.

Need more info?

Encyclopedia of Analytical Chemistry: Applications, Theory and Instrumentation

by Robert A. Meyers

(commissions earned)

Complete list of suggested books

last modified on October 27 2022, 21:28:27.

Dean's Analytical Chemistry Handbook - tam sa fajne (chyba) listy co czym oznaczac, warto obejrzec

Technical info: $section - alkalimetry, $subsection - , $page - HCl, $url_call - acid-base-titration-hydrochloric-acid

EBAS - equation balancer & stoichiometry calculator

Single user license: €24.95

Operating systems: XP, Vista, 7, 8, 10, 11

BPP Marcin Borkowski ul. Architektów 14 05-270 Marki Poland

Mobile +48 606725871

titrations.info ©2009 - 2022 ChemBuddy

Sciencing_Icons_Science SCIENCE

Sciencing_icons_biology biology, sciencing_icons_cells cells, sciencing_icons_molecular molecular, sciencing_icons_microorganisms microorganisms, sciencing_icons_genetics genetics, sciencing_icons_human body human body, sciencing_icons_ecology ecology, sciencing_icons_chemistry chemistry, sciencing_icons_atomic & molecular structure atomic & molecular structure, sciencing_icons_bonds bonds, sciencing_icons_reactions reactions, sciencing_icons_stoichiometry stoichiometry, sciencing_icons_solutions solutions, sciencing_icons_acids & bases acids & bases, sciencing_icons_thermodynamics thermodynamics, sciencing_icons_organic chemistry organic chemistry, sciencing_icons_physics physics, sciencing_icons_fundamentals-physics fundamentals, sciencing_icons_electronics electronics, sciencing_icons_waves waves, sciencing_icons_energy energy, sciencing_icons_fluid fluid, sciencing_icons_astronomy astronomy, sciencing_icons_geology geology, sciencing_icons_fundamentals-geology fundamentals, sciencing_icons_minerals & rocks minerals & rocks, sciencing_icons_earth scructure earth structure, sciencing_icons_fossils fossils, sciencing_icons_natural disasters natural disasters, sciencing_icons_nature nature, sciencing_icons_ecosystems ecosystems, sciencing_icons_environment environment, sciencing_icons_insects insects, sciencing_icons_plants & mushrooms plants & mushrooms, sciencing_icons_animals animals, sciencing_icons_math math, sciencing_icons_arithmetic arithmetic, sciencing_icons_addition & subtraction addition & subtraction, sciencing_icons_multiplication & division multiplication & division, sciencing_icons_decimals decimals, sciencing_icons_fractions fractions, sciencing_icons_conversions conversions, sciencing_icons_algebra algebra, sciencing_icons_working with units working with units, sciencing_icons_equations & expressions equations & expressions, sciencing_icons_ratios & proportions ratios & proportions, sciencing_icons_inequalities inequalities, sciencing_icons_exponents & logarithms exponents & logarithms, sciencing_icons_factorization factorization, sciencing_icons_functions functions, sciencing_icons_linear equations linear equations, sciencing_icons_graphs graphs, sciencing_icons_quadratics quadratics, sciencing_icons_polynomials polynomials, sciencing_icons_geometry geometry, sciencing_icons_fundamentals-geometry fundamentals, sciencing_icons_cartesian cartesian, sciencing_icons_circles circles, sciencing_icons_solids solids, sciencing_icons_trigonometry trigonometry, sciencing_icons_probability-statistics probability & statistics, sciencing_icons_mean-median-mode mean/median/mode, sciencing_icons_independent-dependent variables independent/dependent variables, sciencing_icons_deviation deviation, sciencing_icons_correlation correlation, sciencing_icons_sampling sampling, sciencing_icons_distributions distributions, sciencing_icons_probability probability, sciencing_icons_calculus calculus, sciencing_icons_differentiation-integration differentiation/integration, sciencing_icons_application application, sciencing_icons_projects projects, sciencing_icons_news news.

  • Share Tweet Email Print
  • Home ⋅
  • Science ⋅
  • Chemistry ⋅

How to Write a Lab Report About Titration

Titrations are used to determine an unknown concentration.

How to Calculate & Mix Chemical Solutions

Titrations are standard chemistry laboratory procedures usually used to determine the unknown concentration of a substance. They involve slowly adding a reagent to a reaction mixture until the chemical reaction is complete. The completion of the reaction is usually marked by the color change of an indicator substance. The volume of reagent required to complete the reaction is precisely measured using a burette. Calculations can then be carried out to determine the concentration of the original substance.

Complete your titration ensuring you achieve concordant results. You should have three results within 0.1 cubic centimeters of each other in order to be concordant.

Write your introduction. For a titration, the introduction should include information about what you hope to find out and what substance or product you will be analyzing. Write about the reaction you will be using, including the equation and the conditions required. Include details of the indicator stating the expected color change and writing a brief explanation of the suitability of the chosen indicator.

Describe details of your experimental method in the next section. Include a description of how you made up your solutions, if applicable. State the volume and concentration of any reagents used.

Draw a table to represent the results of your titration. It is customary to write the final burette volume in the first row, the initial burette volume in the second row and the titre in the third row. The titre is calculated by subtracting the initial volume from the final volume. To indicate precision, write all your results in cubic centimeters to two decimal places, adding a zero to the end of the number if necessary. Most standard burettes allow measurement to the nearest 0.05 cubic centimeters. Include all your repeat readings in the table, and indicate which are the concordant results to be used in the calculation of the mean titre. Calculate the mean titre using the concordant results only and record it below your results table.

Calculate your unknown using the mean titre and standard volumetric analysis methods. Lay out your calculations clearly, writing them down in a step-by-step format. This will help you to avoid mistakes, and will also ensure you are given credit for method if you make a minor error. Ensure you add the appropriate units to your answers, and use a suitable degree of precision: usually two decimal places. For guidance on completing the calculations, there are a number of online resources.

Write your conclusion. In a titration, the conclusion is often a simple statement of the experimentally determined parameter. Depending on the aim of the titration, more detail may be required. For example, a brief discussion on whether the results fall within the expected range may be appropriate.

Things You'll Need

Related articles, how to calculate melting & boiling points using molality, acid base titration sources of error improvements, definition of endpoint titration, how to make a 20% sugar solution, how to know when a titration is complete, steps in finding percent yield, the effects of water during a titration experiment, how to calculate the ph titration, how to determine the concentration of a titration, how to make a calibration standard for an hplc, how to calculate the calculations for spectrophotometers, what type of reaction produces a precipitate, how to test for sodium bicarbonate, errors in titration experiments, the advantages of potentiometric titration, titration of sodium carbonate with hydrochloric acid, titration explained, how to identify if a solution is neutral, base or acidic.

  • UCLA Chemistry Department: Some Tips on Writing Lab Reports
  • Germanna Community College: Writing a Formal Lab Report

About the Author

Veronica Mitchell has been a freelancer since 2010, writing mainly in biomedical and health fields, but also covering lifestyle and parenting topics. She has a Master of Arts in veterinary and medical sciences from Cambridge University and is a qualified high-school science teacher.

Photo Credits

laboratory image by Lemonade from Fotolia.com

Find Your Next Great Science Fair Project! GO

Performing a Titration & Volumetric Analysis ( AQA A Level Chemistry )

Revision note.

Stewart

Chemistry Lead

Volumetric Analysis

Required practical 1, performing the titration.

  • The key piece of equipment used in the titration is the burette
  • Since they are analogue instruments, the uncertainty is recorded to  half  the smallest marking, in other words to ±0.05 cm 3
  • The  end point  or  equivalence point  occurs when the two solutions have reacted completely and is shown with the use of an  indicator

Titration, downloadable IB Chemistry revision notes

The steps in a titration

  • A white tile is placed under the conical flask while the titration is performed, to make it easier to see the colour change

Titration apparatus, downloadable AS & A Level Chemistry revision notes

  • Measuring a known volume (usually 20 or 25 cm 3 ) of one of the solutions with a  volumetric   pipette  and placing it into a  conical flask
  • To start with, the burette will usually be filled to 0.00 cm 3
  • A few drops of the  indicator  are added to the solution in the conical flask
  • The tap on the  burette  is carefully opened and the solution added, portion by portion, to the  conical flask  until the  indicator  starts to change colour
  • You should be able to close the tap on the burette after one drop has caused the colour change
  • Concordant results are within 0.1 cm 3  of each other

Recording and processing titration results

  • Both the initial and final  burette  readings should be recorded and shown to a  precision  of  ±0.05 cm 3 , the same as the  uncertainty

Titration results, downloadable IB Chemistry revision notes

A typical layout and set of titration results

  • The  uncertainty  is doubled, because two  burette  readings are made to obtain the  titre  (V final – V initial), following the rules for  propagation of uncertainties
  • Concordant  results are then averaged, and non-concordant results are discarded
  • The appropriate calculations are then done

Percentage Uncertainties

  • Percentage uncertainties  are a way to compare the significance of an  absolute uncertainty  on a measurement
  • This is not to be confused with  percentage error , which is a comparison of a result to a literature value
  • The formula for calculating percentage uncertainty is as follows:

method for titration experiment

  • When you are adding or subtracting two measurements then you add together the  absolute  measurement uncertainties
  • Using a balance to measure the initial and final mass of a container
  • Using a thermometer for the measurement of the temperature at the start and the end
  • Using a burette to find the initial reading and final reading
  • In all these example you have to read the instrument  twice  to obtain the quantity
  • If each you time you read the instrument the measurement is ‘out’ by the stated uncertainty, then your final quantity is potentially ‘out’ by  twice  the uncertainty

You've read 0 of your 0 free revision notes

Get unlimited access.

to absolutely everything:

  • Downloadable PDFs
  • Unlimited Revision Notes
  • Topic Questions
  • Past Papers
  • Model Answers
  • Videos (Maths and Science)

Join the 100,000 + Students that ❤️ Save My Exams

the (exam) results speak for themselves:

Did this page help you?

Author: Stewart

Stewart has been an enthusiastic GCSE, IGCSE, A Level and IB teacher for more than 30 years in the UK as well as overseas, and has also been an examiner for IB and A Level. As a long-standing Head of Science, Stewart brings a wealth of experience to creating Topic Questions and revision materials for Save My Exams. Stewart specialises in Chemistry, but has also taught Physics and Environmental Systems and Societies.

Your browser is not supported

Sorry but it looks as if your browser is out of date. To get the best experience using our site we recommend that you upgrade or switch browsers.

Find a solution

  • Skip to main content
  • Skip to navigation

method for titration experiment

  • Back to parent navigation item
  • Primary teacher
  • Secondary/FE teacher
  • Early career or student teacher
  • Higher education
  • Curriculum support
  • Literacy in science teaching
  • Periodic table
  • Interactive periodic table
  • Climate change and sustainability
  • Resources shop
  • Collections
  • Post-lockdown teaching support
  • Remote teaching support
  • Starters for ten
  • Screen experiments
  • Assessment for learning
  • Microscale chemistry
  • Faces of chemistry
  • Classic chemistry experiments
  • Nuffield practical collection
  • Anecdotes for chemistry teachers
  • On this day in chemistry
  • Global experiments
  • PhET interactive simulations
  • Chemistry vignettes
  • Context and problem based learning
  • Journal of the month
  • Chemistry and art
  • Art analysis
  • Pigments and colours
  • Ancient art: today's technology
  • Psychology and art theory
  • Art and archaeology
  • Artists as chemists
  • The physics of restoration and conservation
  • Ancient Egyptian art
  • Ancient Greek art
  • Ancient Roman art
  • Classic chemistry demonstrations
  • In search of solutions
  • In search of more solutions
  • Creative problem-solving in chemistry
  • Solar spark
  • Chemistry for non-specialists
  • Health and safety in higher education
  • Analytical chemistry introductions
  • Exhibition chemistry
  • Introductory maths for higher education
  • Commercial skills for chemists
  • Kitchen chemistry
  • Journals how to guides
  • Chemistry in health
  • Chemistry in sport
  • Chemistry in your cupboard
  • Chocolate chemistry
  • Adnoddau addysgu cemeg Cymraeg
  • The chemistry of fireworks
  • Festive chemistry
  • Education in Chemistry
  • Teach Chemistry
  • On-demand online
  • Live online
  • Selected PD articles
  • PD for primary teachers
  • PD for secondary teachers
  • What we offer
  • Chartered Science Teacher (CSciTeach)
  • Teacher mentoring
  • UK Chemistry Olympiad
  • Who can enter?
  • How does it work?
  • Resources and past papers
  • Top of the Bench
  • Schools' Analyst
  • Regional support
  • Education coordinators
  • RSC Yusuf Hamied Inspirational Science Programme
  • RSC Education News
  • Supporting teacher training
  • Interest groups

A primary school child raises their hand in a classroom

  • More navigation items

A thermometric titration

In association with Nuffield Foundation

  • No comments

Use this class practical to practise locating the end-point of a titration by measuring the temperature change

In this experiment, students titrate sodium hydroxide solution with hydrochloric acid. By measuring the temperature change each time a portion of acid is added, students can determine the end-point of the titration, indicated by the highest temperature. They then use this information to calculate the concentration of the hydrochloric acid.

The practical takes about one hour, and is best carried out individually or in pairs.

  • Eye protection (goggles)
  • Thermometer, 0–100 °C (see note 5 below)
  • Two insulated (polystyrene) cups
  • Beaker, 250 cm 3
  • Burette, 50 cm 3
  • Burette stand
  • Clamp and stand (optional)
  • Cork, one-holed, to fit thermometer (optional)
  • Pipette, 20 cm 3 or 25 cm 3
  • Pipette safety filler
  • Hydrochloric acid, 2.00 M (IRRITANT), about 75 cm 3
  • Sodium hydroxide solution, 1.50 M (CORROSIVE), about 30 cm 3

Health, safety and technical notes

  • Read our standard health and safety guidance.
  • Wear eye protection throughout.
  • Hydrochloric acid, HCl(aq), (IRRITANT at concentration used) – see CLEAPSS Hazcard  HC047a  and CLEAPSS Recipe Book RB043. This concentration is necessary to achieve a reasonable change in temperature. The concentration of the hydrochloric acid should not be indicated on bottle available to the students.
  • Sodium hydroxide solution, NaOH(aq), (CORROSIVE at concentration used) – see CLEAPSS Hazcard  HC091a  and CLEAPSS Recipe Book RB085. This concentration is necessary to achieve a reasonable change in temperature. The concentration of the sodium hydroxide should be indicated on bottle available to the students.
  • Instead of using the thermometer to stir the titration mixture, it could be clamped in position in a cork, as shown in the diagram, and the mixture swirled after each addition of acid. Alternatively, a temperature sensor attached to a computer can be used in place of a thermometer. Data logging software could then be used to provide a detailed plot of the readings.
  • Stand an insulated cup in a beaker for support.

A diagram showing the equipment required for a thermometric titration using hydrochloric acid

Source: Royal Society of Chemistry

In this thermometric titration, students can determine the end-point of the titration using the highest temperature recorded during the experiment

  • Using a pipette and safety filler, transfer 20 cm 3 (or 25 cm 3 ) of the sodium hydroxide solution into the cup, and measure the steady temperature.
  • Using the burette, add a small portion (3–5 cm 3 ) of dilute hydrochloric acid to the solution in the cup, noting down the actual volume reading. Stir by swirling the cup and measure the highest temperature reached.
  • Immediately add a second small portion of the dilute hydrochloric acid, stir, and again measure the highest temperature and note down the volume reading.
  • Continue in this way until there are enough readings to decide the maximum temperature reached during this experiment. You will need to add at least 30 cm 3 of the acid.
  • Plot a graph of temperature against the volume of acid added, and use extrapolation of the two sections of the graph to deduce the maximum temperature reached without heat loss.
  • Use your results to calculate the concentration of the hydrochloric acid.

Teaching notes

The main concern in this experiment is the heat loss. If possible, a lid should be used. More reliable results can be achieved using two polystyrene cups (one inside the other).

With abler or older students, it is possible to discuss the extrapolation of the cooling curve to estimate the maximum temperature reached without heat loss. Creative Chemistry provide a resource on thermometric titration which includes an example of a typical plot of temperature vs volume of acid for this experiment, as well as the use of extrapolation to determine the maximum temperature change.

To reinforce the theory involved here, an indicator could also be used to show that the end-point really did occur at the highest temperature.

Additional information

This is a resource from the  Practical Chemistry project , developed by the Nuffield Foundation and the Royal Society of Chemistry. This collection of over 200 practical activities demonstrates a wide range of chemical concepts and processes. Each activity contains comprehensive information for teachers and technicians, including full technical notes and step-by-step procedures. Practical Chemistry activities accompany  Practical Physics  and  Practical Biology .

The experiment is also part of the Royal Society of Chemistry’s Continuing Professional Development course:  Chemistry for non-specialists .

© Nuffield Foundation and the Royal Society of Chemistry

  • 14-16 years
  • 16-18 years
  • Practical experiments
  • Acids and bases
  • Quantitative chemistry and stoichiometry
  • Reactions and synthesis

Specification

  • (e) simple procedures to determine enthalpy changes
  • determine the enthalpy changes for combustion and neutralisation using simple apparatus; and
  • 2.8.6 recall experimental methods to determine enthalpy changes;
  • 1.8.11 investigate the temperature change during neutralisation and demonstrate understanding that neutralisation reactions are exothermic (heat is given out);
  • 1.8.10 investigate the temperature change during neutralisation and demonstrate understanding that neutralisation reactions are exothermic (heat is given out);

Related articles

A diagram and graph showing how a reversible reaction reaches equilibrium

Help learners master equilibrium and reversible reactions

2024-06-24T06:59:00Z By Emma Owens

Use this poster, fact sheet and storyboard activity to ensure your 14–16 students understand dynamic equilibrium

A hand using scissor-handle tweezers to hold a piece of paper that is on fire but not burning

Non-burning paper: investigate the fire triangle and conditions for combustion

2024-06-10T05:00:00Z By Declan Fleming

Use this reworking of the classic non-burning £5 note demonstration to explore combustion with learners aged 11–16 years

A bottle of bromine water next to two test tubes - one contains only clear liquid and the other contains clear liquid sitting on an orange liquid

Everything you need to introduce alkenes

2024-06-04T08:22:00Z By Dan Beech

Help your 14–16 learners to master the fundamentals of the reactions of alkenes with these ideas and activities

No comments yet

Only registered users can comment on this article., more experiments.

Image showing a one page from the technician notes, teacher notes, student sheet and integrated instructions that make up this resource, plus two bags of chocolate coins

‘Gold’ coins on a microscale | 14–16 years

By Dorothy Warren and Sandrine Bouchelkia

Practical experiment where learners produce ‘gold’ coins by electroplating a copper coin with zinc, includes follow-up worksheet

potion labels

Practical potions microscale | 11–14 years

By Kirsty Patterson

Observe chemical changes in this microscale experiment with a spooky twist.

An image showing the pages available in the downloads with a water bottle in the shape of a 6 in the foreground.

Antibacterial properties of the halogens | 14–18 years

By Kristy Turner

Use this practical to investigate how solutions of the halogens inhibit the growth of bacteria and which is most effective

  • Contributors
  • Email alerts

Site powered by Webvision Cloud

method for titration experiment

Neutralisation (chemistry only)

Required practical 2, core practicals.

method for titration experiment

Aims of Experiment

Foundation tier.

Determination of the reacting volumes of solutions of a strong acid and a strong alkali by titration.

In this experiment you will:

  • use a burette and colour change indicator to find out the volume of sulfuric acid that neutralises 25 ml of sodium hydroxide solution

Higher Tier

Determination of the reacting volumes of solutions of a strong acid and a strong alkali by titration. Determination of the concentration of one of the solutions in mol/dm 3 and g/dm 3 from the reacting volumes and the known concentrations of other solutions

  • use a burette and colour change indicator to find out the volume of sulfuric acid that neutralises 25 ml of 0.1 mol/dm 3 sodium hydroxide solution
  • use your results to calculate the concentration of the sulfuric acid in mol/dm 3 and in g/dm 3

Risk Asessment

As a general rule, eye protection (goggles) must be worn for all practicals.

hazard possible harm precaution
dilute sodium hydroxide solution
skin irritation and serious eye irritation
wear gloves, use a pipette filler
dilute hydrochloric acid
skin irritation and eye irritation
fill burette slowly (below eye level), using a funnel

This risk assessment is provided as an example only, and you must perform your own risk assessment before doing this experiment.

Each group will need:

burette burette stand or retort stand with burette clamp plastic funnel to fit in top of burette 25.0 ml pipette pipette filler

conical flask white tile phenolphthalein indicator hydrochloric acid  sodium hydroxide solution access to distilled/de‐ionised water

Experiment Set-up

method for titration experiment

  • use a pipette and pipette filler to add 25 ml of sodium hydroxide to a clean conical flask
  • add a few drops of phenolphthalein indicator and place the conical flask on a white tile
  • fill the burette with hydrochloric acid and record the starting volume
  • slowly open the tap of the burette, and add the acid to the conical flask, swirling to mix
  • stop adding the acid when the end-point is reached (when the colour permanently changes from pink to colourless) and record your final volume 
  • repeat steps 1-5 until you get concordant titres (results are within 0.10 ml of each other)

Results and Analysis

rough run 1 run 2 run 3
26. 55 26.35 26.80 26.25
0.00 0.15 0.50 0.00
26.55 26.20 26.30 26.25

Readings should be recorded to two decimal places, ending in 0 or 5.  The titre is the volume added (the difference between the final and starting volumes).

Select at least two concordant titres (these are titres within 0.10 ml of each other) and work out an average titre. Use this volume of acid to work out its concentration.

Exam Question and Model Answer

A student has to check if two samples of hydrochloric acid, A and B, are the same concentration. Describe how the student could use the apparatus (burette, pipette, conical flask, white tile) and the solutions (indicator, HCl  A , HCl  B , NaOH solution) to carry out titrations.

Level 1 (1-2 marks)

Use a pipette to measure the acid into a conical flask, then add alkali from the burette.

Level 2 (3-4 marks)

Add hydrochloric acid, using a pipette, into a conical flask. Fill a burette with the sodium hydroxide solution, then add a few drops of indicator into the conical flask. Slowly add the alkali to the flask and swirl the flask whilst looking for a colour change. Once a sudden colour change has occurred, stop adding alkali, and record the volume of alkali added from the burette.

Level 3 (5-6 marks)

Ensure you are wearing safety goggles and measure 25 ml of hydrochloric acid A, using a pipette and pipette filler, into a conical flask. Fill a burette safely with the sodium hydroxide solution, then add a few drops of indicator into the conical flask. Slowly add the alkali, drop by drop, to the conical flask and swirl the flask whilst looking for a colour change. Using a white tile under the flask can help to see this. Once a sudden colour change has occurred, stop adding alkali, and record the volume of alkali added from the burette. Repeat this again for the hydrochloric acid B - and if the same volume of alkali neutralises the acids, the two acids are of the same concentration.

a titration experiment can be used to determine the

exact amount of a substance

Explanation:

Experiment Titration is an analytical method used to determine the exact amount of a substance by reacting that substance with a known amount of another substance.

acid solution (of known concentration) required to neutralize it. The purpose of the titration is the detection of the equivalence point, the point at which chemically equivalent amounts of the reactants have been mixed. The amount of reactants that have been mixed at the equivalence point depends on the stoichiometry of the reaction.

Related Questions

To the heated water 0.5 kg of water at t3 = 20° c is added. what is the final temperature of the water, in kelvin?

The final temperature of the water after addition to the heated water at 20° C in degree kelvins' is calculated as; 295.23 K

We are given;

mass of the initial water; m₁ = 2.5 kg

specific heat capacity of water; c = 4189 J/kg.K

initial temperature of water; T₁ = 13.5 ⁰C

final temperature of the water; T₂ = 22.5 ⁰C

mass of the final water; m₂ = 0.5 kg

initial temperature of the final water; T₁,i = 20 ⁰C

If the system is isolated , then we have;

m₁*c*(T_f - T₂) + m₂*c*(T_f - T₁,i) = 0

c will cancel out to give;

[2.5T_f - (2.5*22.5)] + [0.5T_f - (0.5*20)] = 0

2.5T_f - 56.25 + 0.5T_f - 10 = 0

3T_f = 66.25

T_f = 66.25/3

T_f = 22.08°C = 295.23 K

Read more on final temperature at; https://brainly.com/question/19169125

Ecoskate makes skateboards from recycled plastic. for a recent job lot of 100 skateboards, the company incurred direct materials costs of $600 and direct labor costs of $200. factory overhead applied to this job is $900. required: 1. what is the total manufacturing cost of this job lot? 2. what is the cost per skateboard?

32$ per skateboard for this question

At which event must special care be taken when preparing food

During occasions such as Easter, Christmas etc when preparing a food take risk and measures make it delicious

From a point 54.0 feet from the base of a flagpole, the angle of elevation to the top of the flagpole is 68.5°. find the height of the flagpole.

The flagpole forms a right-triangle with its base and its top

The height of the flagpole is 137.1 feet

To determine the height , we make use of the following tangent trigonometry ratio

[tex]\tan(68.5) = \frac{h}{54.0}[/tex]

h represents the height of the flagpole .

So, we have:

[tex]h = 54.0 * \tan(68.5)[/tex]

[tex]h = 137.1[/tex]

Hence, the height of the flagpole is 137.1 feet

Read more about right triangles at:

https://brainly.com/question/2437195

Rank the following different combinations of m and r on the basis of the angular speed of the merry-go-round after the sandbag "sticks" to the merry-go-round.

The angular speed simply describes the way that things turn which is described in units such as revolutions per minutes, degree per seconds , etc.

Your information is incomplete as the diagram isn't provided. Therefore, an overview will be given.

It should be noted that angular speed simply means the measure of how fast the central angle of the rotating body changes with respect to time .

The angular speed is simply calculated by multiplying the angle of rotation and the time taken to complete the rotation .

Learn more about angular speed on:

https://brainly.com/question/6860269

1.0 l of a buffer is prepared. it contains 0.125 m ha (pka = 4.74) and 0.115 m a−. what is the ph of this buffer after 0.0100 mol of strong acid is added?

pH = pKa + log(base/acid)

4-4 skills practice parallel and perpendicular lines

An example of parallel and perpendicular lines are the steps walk of a straight ladder, the opposite sides of a rectangle.

When there are two non vertical lines that are in found to be in the same plane such as the same slope , then a person can say that the lines are parallel .

But when two non- vertical lines in that are same to be of the same plane intersect at a right angle one can therefore say that they are perpendicular lines.

An example is "write an equation in slope-intercept form for the line that passes through the given point and is parallel to the graph of the given equation". The equation that fits the graph (attached) is y = 2x + 1.

Learn more about perpendicular lines from

https://brainly.com/question/1202004

It refers to any software that is installed on a computer’s hard drive.

A p p l i c a t i o n S o f t w a r e s

Read the following scene from the inheritors. Fred jordan's cell. Slowly, at the end left unchalked, as for a door, she goes in. Her hand goes up as against a wall; looks at her other hand, sees it is out too far, brings it in, giving herself the width of the cell. Walks its length, halts, looks up. ) and one window—too high up to see out. (in the moment she stands there, she is in that cell; she is all the people who are in those cells. Emil johnson [who works at the courthouse], appears from outside. ) madeline: (stepping out of the cell door, and around it) hello, emil. Emil: how are you, madeline? how do, mr morton. (ira barely nods and does not turn. Emil turns back to madeline) well, i'm just from the courthouse. Looks like you and i might take a ride together, madeline. You come before the commissioner at four. A possible disadvantage to watching this scene, as opposed to reading it silently, is that viewers are required to conceptualize the setting of the jailhouse. Required to interpret movements in absence of stage directions. Required to imagine the appearance of the characters. Required to visualize the props used within the scene

One of the disadvantages of watching the scene rather than reading it is the difficulty in interpreting the movements in the absence of stage directions .

The stage directions shown in the text above show how actors should move through stage directions . This is shown in detail and specifies that it can be missed if the scene is watched and not read.

More information on stage directions is at the link:

https://brainly.com/question/404162

Choose the correct percentage to complete the sentence. more than of organizations in the united states report that they are unprepared for even basic security attacks.

More than 70% of organizations in the United States report that they are unprepared for even basic security attacks.

A security attack is a type of computer attack aimed at stealing , damaging and/or exposing digital information.

A security attack may be aimed, for example, to steal passwords in a given bank or financial organization.

The number of security attacks has increased in a sudden manner in the last years around the world.

Learn more about security attacks here:

https://brainly.com/question/7449721

Based on the model of cellular transport, the conversion of atp to adp provides a mechanism for

Based on the model of cellular transport , the transport of a substance against its electrochemical gradient is accomplished with energy input from ATP .

It is a cellular mechanism by which some molecules cross the plasma membrane against a concentration gradient with the consequent expenditure of energy .

The carrier proteins that intervene in the transport of molecules require an energy supply , in the form of ATP , it is carried out at the expense of respiration and photosynthesis processes; by hydrolysis of ATP by membrane ATP hydrolases .

Therefore, we can conclude that based on the model of cellular transport , the transport of a substance against its electrochemical gradient is accomplished with energy input from ATP .

Learn more about active transport here: https://brainly.com/question/13244915

What type of fallacy or faulty reasoning is used in this passage? ad populum begging the claim genetic fallacy hasty generalization

The type of fallacy or faulty reasoning which is used in this passage about a Seminal US Document is: D. hasty generalization .

Hasty generalization can be a type of fallacy or faulty reasoning that involves making a claim or drawing a conclusion based on very little evidence or instances of an event .

In this scenario, we can deduce that the  type of fallacy or faulty reasoning which is used in this passage about a Seminal US Document is hasty generalization because the argument isn't logically justified by enough empirical evidence .

Read more on fallacy here: https://brainly.com/question/1395048

Answer: D Hasty Generalization

"That it would not in any part of the civilized world be supposed to embrace the negro race, which, by common consent" The Speaker is using a Generalization of the Founding Fathers to think they would not include the African Americans who were enslaved as "Citizens" despite some being born there.

Joseph was given a large box of 54 chocolates for his birthday. if he eats exactly 5 chocolates each day, how many chocolates would joseph have remaining 8 days after his birthday?

14 chocolates

Joseph ate 5 chocolates each day, so after 8 days, he would have eaten 40 chocolates. so since at first he have 54 chocolates, take 54 and minus 40 and you will get 14 chocolate left

In addition to deep sea organisms, there are many species found throughout the ocean. the numbers and relative proportions of bacteria and archaea change with depth in response to changing conditions. viruses that infect the prokaryotic organisms play a variety of important roles in this habitat, including control of their overall numbers and facilitation of horizontal gene transfer. choose whether each statement best describes bacteria, archaea, or viruses.

The statements are not found in the question but it is important to highlight that viruses are not living forms and bacteria and archaea are prokaryotic organisms.

Prokaryotic organisms such as bacteria and Archaea are simpler forms of life that lack a cell nucleus and membrane-bound organelles.

Viruses are not living things because they need a suitable host to survive (i.e., viruses are replicative entities ).

Some characteristics of Archaea include:  

Learn more about prokaryotic organisms here:

https://brainly.com/question/22517662

If a+b=-8 and a + b = 50, what is the a value of ab?

sorry is that question correct pls

Imagine that we randomly select a day from the past 10 years

which day will you select?:-)

A store has a sale where all hats are sold at a discount of 40

Assuming the regular price of the jackets is $80. The number of  jackets that could be bought at the sale if a shopper spent $576​ is: 12 jacket.

First step is to find new price using this formula

New price=Regular price×(100-Discount)

New price=$80×(100%-40%)

New price=$80×60%

New price=$48

Second step is to find the number of sold jackets

Number of sold jacket=Amount spent/New price

Number of sold jacket=576 / 48

Number of sold jacket= 12 jackets

Inconclusion the number of  jackets that could be bought at the sale if a shopper spent $576​ is: 12 jacket.

Learn more about number of sold jacket here:https://brainly.com/question/26486085

https://brainly.com/question/23430304

What is the temperature of 12.20 mol of gas in a 18.35 l tank at 16.40 atm? round your answer to the tenths place.

Based on the calculations, the temperature of this ideal gas is equal to 300.5 K .

Mathematically, the temperature of an ideal gas is given by this formula:

[tex]PV=nRT\\\\T=\frac{PV}{nR}[/tex]

Given the following data:

Number of moles = 12.20 moles.

Volume = 18.35 L.

Pressure = 16.40 atm.

Substituting the given parameters into the formula, we have;

[tex]T=\frac{16.40 \times 18.35}{12.20 \times 0.0821}\\\\T=\frac{300.94}{1.00162}[/tex]

T = 300.5 K .

Read more on temperature here: brainly.com/question/3173452

Every real zero of a polynomial function appears as​ a/an

to 0 are called the zeros of f. These values of x are the roots, or solutions, of the polynomial equation f(x) = 0. Each real root of the polynomial equation appears as an x-intercept of the graph of the polynomial function.

You are playing a game where you are rolling a fair 6 sided number cube

if I'm not wrong you might be talking about the game Dice???

Envisionmath 2.0, additional practice workbook, accelerated grade 7 solutions

An example of Envision math 2.0, additional practice work is how many  percussionists in the orchestra of 20% . 60.

The Envision Math 2. 0 is known to be a kind of additional work that was made for Grade 7 by a man known as Scott Foresman so as to improve the math knowledge of the student.

To solve for the   Percentages , note that 20% can still be written as 0.2.

To calculate the number of percussionists , we can say that:

Therefore, there are 12 percussionists in the above orchestra.

Learn more about Envision Math  from

https://brainly.com/question/27155101

The cj bacteria in the chickens at monita farms have a high frequency of the allele that causes fq resistance. If genetic drift was the cause, would this allele also be in bacteria at the original farm?

If the process of genetic drift was the cause of this phenomenon, then the resistance allele was also present in the original farm.

Genetic drift is a genetic phenomenon that occurs when one allele is fixed in a population due to random chance.

Genetic drift is converse to natural selection , where an allele increases this frequency due to evolutionary constraints.

Genetic drift is well known to be the cause of allele fixation by founder population effects.

Learn more about genetic drift here:

https://brainly.com/question/22924933

Calculate the number of moles present in 1.29 x 10²⁴ molecules of hf

According to Avogadro's number there are  atoms present in one mole.

Therefore, we will calculate the number of moles present in  atoms as follows.

                Number of moles =

                                            = 2.14 mol

If you’ve insured a home for $200,000 and the home is only worth $150,000, you can only receive $150,000 at the most if you file a claim.

200,000 - 150,000 = 150,000

A 2-column table with 4 rows. The first column labeled elevation (meters) has entries 500, 1000, 1500, 2000. The second column labeled temperature of air (degrees celsius) has entries 11. 8, 8. 5, 5. 3, 2. 0. As elevation increases, temperature decreases. At which elevation will sound travel fastest? 500 meters 1,000 meters 1,500 meters 2,000 meters

500 on edge :)

A The first one! 500!

I got it right.

Why should Christians fight against spread of devil worship in the society​

Christians fight against spread of devil worship​ because they believed the devil is the one who makes people to do bad/evil thing and when he is worshipped, the devil will have more power to oppress and control people .

Theistic Satanism is known to be a Religious belief that is often called religious Satanism, spiritual Satanism, etc.

It is known as the body of people or groups that sees Satan to be an their god and as such the bible states that the work of Satan is to do evil and separate man from God. Christians are against the worship of a being who leads others to eternal doom and to do evil.

Learn more about Christians from

https://brainly.com/question/855630

6-7 skills practice solving radical equations and inequalities

There are different types of math problems . An example of radical equations and inequalities practice question is [tex]\sqrt{x}[/tex]  = 5

The term radical inequality is known to be a form of an inequality that maintains a variable expression that is present within it.

For the above question , find the [tex]\sqrt{x}[/tex] = 5

The next step is to square both side:

When you square both side, it will be

Learn more about radical inequality from

https://brainly.com/question/25243740

A board that is 12 feet long must be cut into two pieces

If you're asking how long each piece is it will be 6 feet.

12 divided by 2 is 6.

__________ is bordered by two central asian countries. a. the harirud river b. the caspian sea c. the aral sea d. lake balkhash please select the best answer from the choices provided a b c d

Answer: The Aral sea

Explanation: hope this helps! :)

the elastic rebound theory for the origin of earthquakes was first proposed by ________ following the ________ earthquake.

1. 1906 2. San Francisco

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • View all journals
  • Explore content
  • About the journal
  • Publish with us
  • Sign up for alerts
  • Open access
  • Published: 29 June 2024

Proton-pumping photoreceptor controls expression of ABC transporter by regulating transcription factor through light

  • Jin-gon Shim 1   nAff3 ,
  • Kimleng Chuon 1 ,
  • Ji‐Hyun Kim   ORCID: orcid.org/0009-0001-4610-111X 1 ,
  • Sang-ji Lee 1 ,
  • Myung-chul Song 1 , 2 ,
  • Shin-Gyu Cho   ORCID: orcid.org/0000-0001-9259-7905 1 , 2 ,
  • Chenda Hour 1 &
  • Kwang-Hwan Jung   ORCID: orcid.org/0000-0002-0828-6539 1  

Communications Biology volume  7 , Article number:  789 ( 2024 ) Cite this article

Metrics details

  • Membrane proteins
  • Transcriptional regulatory elements

Light is a significant factor for living organisms with photosystems, like microbial rhodopsin—a retinal protein that functions as an ion pump, channel, and sensory transduction. Gloeobacter violaceus PCC7421, has a proton-pumping rhodopsin gene, the Gloeobacter rhodopsin (GR). The helix-turn-helix family of transcriptional regulators has various motifs, and they regulate gene expression in the presence of various metal ions. Here, we report that active proton outward pumping rhodopsin interacted with the helix-turn-helix transcription regulator and regulated gene expression. This interaction is confirmed using ITC analysis ( K D of 8 μM) and determined the charged residues required. During in vitro experiments using fluorescent and luciferase reporter systems, ATP-binding cassette (ABC) transporters and the self-regulation of G. violaceus transcriptional regulator (GvTcR) are regulated by light, and gene regulation is observed in G. violaceus using the real-time polymerase chain reaction. These results expand our understanding of the natural potential and limitations of microbial rhodopsin function.

Similar content being viewed by others

method for titration experiment

A blue light receptor that mediates RNA binding and translational regulation

method for titration experiment

Transmission of light signals from the light-oxygen-voltage core via the hydrophobic region of the β-sheet surface in aureochrome-1

method for titration experiment

Class II LitR serves as an effector of “short” LOV-type blue-light photoreceptor in Pseudomonas mendocina

Introduction.

In living organisms, photoreceptors have been classified as photosensors, light-sensing photoconverters, or energy-converting photoreceptors. Various photoreceptors trigger photo movements at various levels—organ translocation and intracellular movements—including photoreceptors with functions in higher species such as plants 1 . Phytochromes, which regulate the subsequent adaptation of plant growth and development, are photoreceptors that absorb red and far-red light (600–750 nm). Cryptochromes and phototropins, which enable absorption and regulation of blue light, UV-A and B (320–500 nm), can be used to monitor almost all facets of light in organism 2 . In addition, photosensory complexes exist such as the microbial rhodopsins and the photosynthetic reaction centers, that function as ion transporters, channels, or energy converters. Antenna pigments (e.g., accessory pigments such as carotenoids and chlorophylls) can bind and form a secondary chromophore. The diversity of photoreceptors has been reported as an essential factor for their function and the differentiation within living organisms 3 , 4 .

Microbial rhodopsin, a type I rhodopsin, is a photoactive retinal-binding protein that is abundant in the natural environment 5 . Microbial rhodopsins comprise seven transmembrane alpha-helices that absorb light through retinal chromophores and function as ion transporters, ion channels, and photosensing transductors 5 . Microbial rhodopsin is found in numerous marine microorganisms that live in the photic zone of oceans and freshwater 6 . Recently, heliorhodopsin (HeR), characterized by its reverse orientation, has been reported to be widely present in organisms 7 . HeR has been shown to bind to photolyase following light exposure, thereby enhancing DNA repair activity, and this activity is regulated by binding to glutamine synthetase 8 , 9 . Microbial rhodopsin has evolved various functions. Among them, Gloeobacter rhodopsin (GR), which is similar to xanthorhodopsin, exerts a proton-pumping function 10 . Goeobacter violaceus PCC7421, cyanobacteria lacking the thylakoid membrane and photosystem, replaces the photosystem with GR. Various carotenoids exist in cells and GR binds to them to form a secondary chromophore and broaden its function 11 , 12 .

ATP-binding cassette (ABC) transporters are a large superfamily of membrane proteins present in all living organisms (e.g. bacteria, archaea, and eukarya, including humans) 13 , 14 . ABC transporters comprise four parts: two each of membrane-integrating and ATP-hydrolyzing domains 15 . The typical structure of eukaryotic ABC transporters consists of two conserved domains: a transmembrane domain (TMD) and nucleotide-binding domain (NBD). In contrast, the modules are mostly fused to form a single polypeptide chain and bacterial ABC transporters comprise individual subunits in eukaryotic systems. They are involved in various processes such as signal transduction, protein secretion, drug and antibiotic resistance, antigen presentation, bacterial pathogenesis, sporulation, and nutrient uptake in bacteria 16 . Moreover, they have a multidrug extraction function of toxic substances, which can lead to resistance of cancer cells to drugs used in chemotherapy.

Various mechanisms regulate gene expression, and genes are regulated under specific conditions 17 . Helix-turn-helix (HTH) regulatory proteins regulate gene expression and are classified into two functional types as: activators or repressors. They are distinguished by the positively and negatively regulated transcription of target genes as activators and repressors, respectively 18 . The HTH transcriptional regulator ( bmrR ) of Bacillus subtilis , MerR family, is a group of transcriptional activators that regulates bmr , the multidrug resistance gene. In contrast, the HTH transcriptional regulator ( zntR ) of Escherichia coli regulates the zntA transport gene 19 . The HTH transcriptional regulatory proteins, with an abundant motif present in proteins, respond to stress induced by heavy metal toxicity or gene expression regulation without metal ions 20 . The HTH transcriptional regulator binds with metal, fatty acid, tetracycline, and various substances to regulate their genome and to allow the expression of resistance genes to remove, detoxify, or neutralize xenobiotics and ultimately enabling living organisms to survive in harsh environments 21 .

Here, microbial rhodopsin is hypothesized to be involved in gene regulation; therefore, various transcription regulators in G. violaceus PCC7421 were investigated. Among the microbial rhodopsins, we found that Heliorhodopsin can function by binding to other proteins, which gave us clues to the binding of transcriptional regulators and microbial rhodopsins 8 , 9 . We aimed to understand the molecular mechanism of gene regulation driven by non-metal-mediated transcriptional regulators under the influence of photoreceptors.

Characterization of GvTcR as HTH-type transcriptional regulators and two promoters that can bind GvTcR

We searched for transcriptional regulators in G. violaceus PCC7421 and found that the genetic sequences of HTH-type transcriptional regulators were similar to those in the operon included Heliorhodopsin gene, and we named the candidate as G. violaceus transcriptional regulator (GvTcR). We classified GvTcRs as HTH-type transcriptional regulators based on similar genetic sequences with reported HTH-type transcriptional regulators and structure predictions (Fig.  1 ). To investigate the information of GvTcR (NCBI accession number: WP_011141437.1), various HTH-type transcriptional regulators were compared based on phylogenetic trees (Fig.  1a ). GvTcR was classified in a group such as KmtR and CmtR, which are metal-responsive transcription repressors that act by binding to promoter regions, and nickel-, cobalt-, cadmium-, and lead-influenced transcription control was expected.

figure 1

a The phylogenetic tree of GvTcR with HTH-type transcription regulators. The evolutionary history was inferred using the UPGMA method 34 . The displayed tree is optimal and drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Poisson correction method was used to compute the evolutionary distances 35 in units of the number of amino acid substitutions per site. Sixty-one amino acid sequences were analyzed. All ambiguous positions were removed for each sequence pair (pairwise deletion option). A total of 347 positions were found in the final dataset. Evolutionary analyses were conducted using MEGA-X 36 . The blue round box indicates classification as a similar group. The red box indicates GvTcR. b Alignment of the GvTcR amino acid sequence with a similar group. Five alpha helix and two beta strands are marked in black boxes. Amino acids that are important for metal bonds are colored. α3 type is indicated in green, α4 type in red, and α5 type in yellow. NCBI reference numbers are as follows: Corynebacterium glutamicum CyeR; WP_003855203.1; Mycobacterium tuberculosis CmtR, WP_072511063.1; Streptomyces coelicolor CmtR, WP_011027409.1; Mycobacterium tuberculosis KmtR, WP_049955289.1; Mycobacterium xenopi MXEN_15450, WP_099868832.1; Streptomyces coelicolor SCO6823, MYU46328.1; Streptomyces sp . plasmid pHZ227 ArsR2, ABB70172.1 c Analysis of structural simulations based on ArsR-based transcriptional regulators (PDB:3F6O). Expected dimers are marked in different colors. The schematics of the promoter region are displayed. d Isothermal titration calorimetry (ITC) analysis shows the binding results for GvTcR with DNA fragments of promoter regions. The top and bottom panels show the raw data and the enthalpy changes. The fitting result is shown in the bottom panel as a continuous line. These experiments were performed at room temperature.

For the unambiguous classification of HTH-type transcriptional regulators, the structural properties of GvTcR were investigated. GvTcR is structurally composed of five alpha helices and two beta strands and has the same composition as other HTH-type transcription regulators (Supplementary Fig.  S1 , Fig.  1b ) 22 . Analyzing structural simulations based on ArsR-based transcriptional regulators (PDB:3F6O), the presence of the N-terminal arm, a region that forms dimers and plays an important role in DNA binding, was also confirmed on structure and sequence analysis (Fig.  1b, c ) 23 . Unlike those classified as a similar sequence to that of KmtR, ITC 200 analyses confirmed that GvTcR was not bound to cobalt, nickel, or other metals; thus, suggesting that it could be adjusted by factors other than metals (Supplementary Fig.  S2 ). Although presenting a similar sequence to that of KmtR, GvTcR showed no motif at the 5 th alpha helix when comparing the major motif sites to which metals bind. In addition, no metal-binding amino acids compared to those in the α3 and α4 groups (Fig.  1b ). As the genetic sequence of GvTcR is similar to that of KmtR, we prioritized the ABC transporter ATP-binding protein, a gene regulated by KmtR, as a candidate. We searched for the ABC transporter ATP-binding protein present in G. violaceus PCC7421 and shortlisted it by comparing it with genes regulated by KmtR. To identify the genes regulated by GvTcR, ABC transporter ATP-binding protein that was referenced at DNA sequences encoding the regulatory genes of KmtR were compared. Further, promoter candidates containing palindromic sequences were selected for areas before the ABC transporter ATP-binding protein gene (NCBI accession number WP_011141998.1). In addition, self-regulation of the GvTcR gene might be possible, and a total of five candidate DNA sequences were explored through promoter prediction (Supplementary Fig.  S3 ). Five candidate groups were compared using isothermal titration calorimetry (ITC), and as predicted, we confirmed that the ABC transporter ATP-binding protein gene and the promoter region encoding GvTcR bind to GvTcR. The dissociation constant ( K D ) of the ABC transporter ATP-binding protein coding promoter (Ap) was 9.25 ± 1.3 μM. In contrast, the dissociation constant ( K D ) of the self-regulated GvTcR coding promoter (Sp) was 19.72 ± 8.3 μM (Supplementary Fig.  S3 , Fig.  1d ). Genetic sequence and structural comparison of GvTcR and thermodynamic analysis of the predicted promoter region showed that GvTcR would function as an HTH-type transcription regulator.

Interaction between GR and GvTcR by photochemical analysis

The function and photochemical properties of GR was hypothesized to be affected when GR interacts with GvTcR and photochemical and photophysical analysis was designed. For comparison, the binding to GvTcR with another membrane protein, proteorhodopsin (PR), was measured by ITC analysis, and the results observed no binding to PR (Supplementary Fig.  S4 ). However, it interacted with GR, with a dissociation constant ( K D ) of 8 ± 3.2 μM (Fig.  2a ). To measure the effectiveness of the combination of the two proteins on the retinal Schiff base, spectroscopic analysis was performed, and the data was observed to be blue, shifting from 538 nm to 533 nm (Fig.  2d ). We obtained similar results for the interaction of HeR and the transducer 8 . It influences the chromophore due to the structural change caused by the relatively strong binding of the two proteins with a reasonable K D 24 , 25 .

figure 2

a Isothermal titration calorimetry (ITC) analysis shows the binding results for GR with GvTcR. The top and bottom panels show the raw data and the enthalpy changes. The fitting result is shown in the bottom panel as a continuous line. b ITC analysis shows the binding results for R69A/K141A double mutant with GvTcR. These experiments were performed at room temperature. c Protein–protein docking simulations (ClusPro 2.0) were performed to predict the binding of GR and GvTcR. Two amino acid sites capable of polar interaction (R69 and K141) are marked with yellow circles as predictions of binding from the intracellular side. d The absorption spectra of GR and GvTcR were measured by adding GvTcR (ratio 1:1) to observe the spectral shift for 40 min. e The spectral shift of the R69A/K141A double mutant. For the wild type, a blue shift was observed. The mutant GvTcR molar ratio was 1:1, and no shifts were observed. f Light-driven proton pumping activities of GR and GR co-expressed with GvTcR. The pumping data purifies GR from each sample after measurement and calculates the same GR expression ratio. The red-dotted line indicates the pumping activity of GR under white light illumination in the presence of 10 mM NaCl. The black-dotted line represents the GR result upon co-expression with GvTcR. g Time-based kinetic study of purified GR with and without GvTcR showed light-dependent molecular conformational change with a clear accumulation of red-shifted species at approximately 600 nm representing O intermediates, and the depletion of the green region while the dark-adapted sample was used as a baseline for G intermediates. The green line indicates the result for GR + GvTcR, the red line indicates the result for GR + BSA, and the blue line indicates GR. The dotted line indicates the dark condition.

GR is proton outward pumping rhodopsin, and the bond with GvTcR was presumed to influence the pumping ability. To co-expression of protein, a vector that can safely control polycistronic gene expression was prepared by introducing a ribosome-binding site (RBS) into a protein expression vector 26 . We observed that the pumping ability was significantly decreased when GR was co-expressed with GvTcR (Fig.  2f ). Further, the purified GR-GvTcR complex from a co-expressed cell was measured in blue-shifted maximum absorption spectra using spectroscopic analysis (Supplementary Fig.  S5 ). Similar to the spectral data, when the two proteins were mixed, a blue shift of 5 nm was observed for the complex (Fig.  2d ). To specify protein binding sites, protein-protein docking simulations (ClusPro 2.0) were performed to predict the binding of GR and GvTcR. Following the protein docking simulation, the results of the binding between the two proteins were obtained, and mutation sites that played an important role in the binding of the two proteins were explored 27 (Fig.  2c ). As three amino acids (R69, K141, and R202) of GR can be involved in polar interactions, the R69, K141, and R202 positions were selected as mutation candidates (Supplementary Fig.  S6 , S7 left lane). The three candidates were substituted with alanine. Although the R202A mutant showed no difference in K D compared to the wild-type, the R69A mutant exhibited a more than 10-fold increase in K D compared to that of the wild-type (Supplementary Fig.  S6 ). The K141A mutant also affected protein binding and the R69A/K141A double mutant was analyzed using ITC ( K D  = 6.2 ± 3.15 mM) (Fig.  2b ). The K D of the R69A/K141A double mutant increased by approximately 10 3 . We confirmed that the shift did not occur differently from the wild type by comparing the spectral shift results for the combination of the R69A/K141A double mutant and GvTcR (Fig.  2e ). This suggests that the positions of R69 and K141 are crucial for protein binding. In addition, changes in protein bands were expected by gel electrophoresis for protein-protein interactions. The binding of GR to GvTcR with and without His tag was compared. The GRs were found to be shifted upward compared to the single GR when the cell lysate containing GvTcR without His tag flowed through. This is a binding-dependent gel shift and considering that the GR R69A/K141A mutant binds weakly, we confirmed the results for cell lysates expressing His tagged GvTcR. In the GR R69A/K141A mutant, the band of GvTcR was measured but no shift occurred. Also, PR did not bind to GvTcR and no band of GvTcR was shown. The binding of GR to GvTcR was measured by pull-down assay, and the mutant showed weak binding (Supplementary Fig.  S7 right lane).

The resulting blue shift of the GR-GvTcR complex can affect the retinal Schiff base through protein binding, which can affect the intrinsic photocycle of GR. A time-based kinetic study of purified GR with or without GvTcR showed light-dependent molecular conformational changes with an accumulation of red-shifted species at approximately 600 nm, representing O intermediates (Fig.  2g ). The green light region was depleted, while the dark-adapted sample was used as the baseline for the G intermediates. In particular, we observed a significantly higher amplitude signal of the blue absorption region, which is estimated to represent the M-like intermediate in the presence of GvTcR compared to those in the presence of GR or GR + BSA (bovine serum albumin) alone (as a control group that does not bind proteins to GR). Absorption changes were continuously assessed under light and darkness at 600, 535, and 355 nm to further investigate the kinetic changes. Interestingly, for GR, GR + BSA, and GR-GvTcR complex, the excitation and relaxation of the 600 nm absorption band were similar in all cases, while for GR and GR + BSA, the corresponding rapid recovery was observed at 535 nm. However, for the GR-GvTcR complex, the absorption recovery was much slower at 535 nm, and the blue band was gradually excited and relaxed at 355 nm, which might represent a deprotonation-like state. A light-dependent differential spectrum scan with higher absorption amplitudes was observed in the blue region (Supplementary Fig.  S8 ). These results suggest that active proton-pumping rhodopsin can bind to transcription regulators and that photochemical properties change through interactions.

GvTcR- and GR-mediated gene regulation

After analyzing the binding results of GR and GvTcR, we hypothesized that GR could regulate the GvTcR gene expression. Hence, we subsequently evaluated whether GvTcR can regulate genes by binding to DNA and transducers. Alternatively, fluorescent reporter gene analysis designed that GvTcR can regulate the ABC transporter ATP-binding protein gene and the GvTcR gene 28 , 29 . If each promoter (Ap, Sp) was operated through GvTcR, the reporter gene, green fluorescent protein (GFP), was expressed (Fig.  3a ). GvTcR bound to each promoter and increased the expression of GFP, indicating that GvTcR serves as an activator (Fig.  3b ). For the comparative experiment, when the non-transformed cells, the only promoter-transformed cells, and the only GvTcR-transformed cells were compared, we observed that promoters were operating weakly, showing a low fluorescence level when only the promoter was introduced. Furthermore, the activation was increased by GvTcR (Supplementary Fig.  S9 ). Candidate promoters (1 P, 3 P) that do not bind GvTcR showed relatively low fluorescence levels. These results suggest that Ap and Sp can act as promoter regions and be regulated by GvTcR. PR was used to analyze whether GvTcR, could bind to GR as an activator (Supplementary Fig.  S10 ). For PR, no differences in the GFP expressed were observed following the addition of GvTcR (with or without the retinal and light source).

figure 3

a Schematic representation of the fluorescent reporter system. GR and GvTcR co-express proteins using cloned vectors. Each promoter (Ap, Sp) is cloned before the reporter protein. Green fluorescent protein (GFP) is expressed as a function of the presence or absence of light. It is a system in which the fluorescence level increases for an activator and decreases for an inhibitor. b Reporter system results are meant to verify the functionality of GvTcR. A bar graph indicates the fluorescent protein changes depending on isopropyl β-D-1-thiogalactopyranoside-induced protein expression. The results for the dark condition are represented by a dark gray bar, and the results for the light condition are represented by a white bar. P -values were assessed using a Student’s t test (**** P  < 0.001; n  = 15 biologically independent samples) c Bar graph comparing fluorescence levels due to GR and GvTcR co-expression in two promoters (Ap and Sp). The upper lane represents the Ap results, and the lower lane represents the Sp results. The graph is marked according to dark and light conditions. When only GvTcR is present, dark gray is used as a differentiator; GvTcR + PR is marked in bright gray; GvTcR + GR is marked in grey; GvTcR + R69A/K141A double mutant is marked in white (**** P  < 0.001; n  = 15, 10 biologically independent samples). d , e Comparison plot box chart for the dark and light conditions at the Ap and Sp promoter from ( c ) (left lane). Dark grey represents the dark condition result while white represents the light condition results. The right lane showed the differences in relative fluorescence ratio at the dark and light conditions for the four sample results. Samples are marked separately on the x -axis. n  = 15 biologically independent samples. All samples with multiple n’s are labeled with an error bar. The standard error is calculated by dividing the standard deviation by the square root of number of measurements.

Differences in light-induced reporter protein expression were observed when GR was present in the promoter (Ap) of the ABC transporter ATP-binding protein gene and that of the GvTcR gene (Sp) (Fig.  3c ). Interestingly, the GFP expression level decreased under dark conditions, suggesting that the gene regulatory function of GvTcR can be affected only by binding to GR. In the case of Ap, it decreased by approximately 20% compared to that observed in the control group (only GvTcR, GvTcR with PR) under dark conditions. In comparison, it decreased by approximately 35% under light conditions (Fig.  3c upper lane). A difference of approximately 15% was observed between the dark and light conditions (Fig.  3d ). Alternatively, similar results were obtained from the R69A/K141A double mutant, as for the control group. This indicates that the function of GvTcR could be controlled by light following the interaction with GR. When GR was present with the Sp promoter, the GFP expression rate was reduced by approximately four times under dark conditions. While in light conditions, it decreased by approximately 25% compared to dark conditions (Fig.  3c lower lane, 3e). Nevertheless, the R69A/K141A double mutant was associated with different results from the wild type when GR was present in Ap. The GFP expression rate of the R69A/K141A double mutant also decreased, such as of the wild-type; however, the GFP expression rate was higher than that of the wild-type under light conditions. This might be due to GR binding as observed from the slight differences in K D values of the R69A/K141A double mutant when compared to those of the wild type. GvTcR has a stronger effect on Sp compared to Ap, suggesting that differences in regulatory levels can be seen in regulating genes. Figure  3d, e (bar graphs at the right) observed slight light effects with the inactive proteins (PR and GR mutant). However, inactive proteins (PR and GR mutant) showed weak binding, which is considered residual activity through this weakened binding.

A luciferase reporter system confirmed that GvTcR could bind to GR and regulate genes through light (Fig.  4a ). We confirmed that the reporter protein was expressed by expressing GvTcR with Ap and Sp. such as the fluorescent reporter system, weak signals appeared only when promoters were present. When GvTcR was co-expressed, high luminescence levels were obtained regardless of the presence or absence of light (Supplementary Fig.  S11 ). To further analyze this aspect, transformed reporter cells were cultured, and induced protein expression in a 24-well plate, following the presence or absence of green light (532 nm) (Fig.  4b ). Similar to the fluorescent reporter system, the luminescence level decreased meaningfully when GR was present in the two promoter regions (Fig.  4c ). In the presence of GR and GvTcR, the luminescence level decreased by approximately 20% for Ap, while for Sp, it decreased by more than 65%. In the presence of PR with GvTcR, luminescence levels were similar to those measured for GvTcR alone. Hence, when GR is present in the Ap or Sp regions, a decrease of approximately 35% can be observed under light conditions (Fig.  4d ). Similar to the fluorescent reporter system, in the luciferase reporter system, GR binds and affects to GvTcR even in the dark. However, a further decrease of approximately 35% under light conditions suggests that GR modulates GvTcR and exerts stronger control by light. These results suggest that the gene regulatory function of GvTcR is affected by GR in the presence or absence of light. These results suggest that the gene regulatory function of GvTcR is affected by the presence or absence of light; however, it is relatively more affected by the binding of the GR itself.

figure 4

a Schematic representations for the luciferase reporter system. GR and GvTcR express proteins using cloned vectors. Each promoter (Ap, Sp) is cloned in front of the reporter protein. Luciferase is expressed according to the presence or absence of light. It is a system in which the luminescence level increases for an activator. b Schematic representation of a 24-well plate experimental course of the luciferase reporter assay. Ampicillin, IPTG, and all-trans-retinal inclusion are indicated in circles. c The relative luminescence intensity according to each condition is indicated in a bar graph. In the presence of GvTcR alone, high luminescence levels were observed; however, in the case of samples containing PR, non-significant changes in luminescence were observed when compared to those measured in the presence of GvTcR alone. P -values were assessed using the Student’s t test; **** P  < 0.001. n  = 8 biologically independent samples. d Graph comparing normalized luciferase activity in the dark and light conditions when GR exists according to each promoter condition. The dark condition is illustrated in the dark grey box and the light condition is indicated in the white box (**** P  < 0.001). n  = 8 biologically independent samples. All samples with multiple n’s are labeled with an error bar. The standard error is calculated by dividing the standard deviation by the square root of number of measurements.

Transcriptional Regulation of GR and ABC transporters by real-time PCR with Gloeobacter violaceus PCC7421

The interaction of GR and GvTcR changes the photochemical properties and affects the proton pumping activity of GR. In addition, GvTcR was found to act as an activator in the promoter region of the two genes through the reporter system and the activator is suppressed in the presence or absence of light through GR. Unlike experiments in E. coli , G. violaceus PCC7421 has the possible effect of the carotenoid antenna pigment of GR. It has been reported that GR increases the light-harvesting function by combining with carotenoids such as salinixanthin and canthaxanthin (CAN), which increases the efficiency of the energy absorbed. We assumed that the light-harvesting function would not significantly affect the binding of GR and GvTcR. It was assumed that changes in mRNA levels would be largely influenced by the combination of GR and GvTcR rather than by the carotenoids of G. violaceus PCC7421. Real-time PCR was designed to indirectly examine the effect of the presence or absence of light on the regulation through GR and GvTcR in G. violaceus PCC7421. RT-PCR was used to study whether GR can control gene expression, which was assumed to be controlled through a variety of complex processes. Time-course measurements were performed while illuminating the organism in the dark. Time-course measurements were performed after changing from light conditions to dark conditions. Primers for each target gene, GR, ABC transporter ATP-binding protein, and GvTcR genes, were tested by concentration to form a single band (Supplementary Fig.  S12 ). We observed a change when transitioning from dark to light conditions, and the mRNA level of the ABC transporter ATP-binding protein decreased to levels that could rarely be measured after 3 h (Fig.  5a ). In the case of GR, the mRNA level began to increase after light irradiation and increased up to 45 times until 7 h. The mRNA level of the GvTcR gene showed an increase at 5 h and was measured up to 14 times. The mRNA level of the GvTcR gene was controlled by the increase in the mRNA level of GR, which was hardly measured during the early stages, and the mRNA level of the ABC transporter ATP-binding protein showed a rapid decrease. Although the transcriptional regulation of GvTcR was suppressed during the early stages of expression, it increased during later stages, thus suggesting that the GR regulation inhibits GvTcR transcription during early stages. In addition, the expression rate of GR transcription increased with light irradiation, suggesting that it operates as a photosystem.

figure 5

Line plot graph comparing relative quantification values for each condition. a After three days of adaptation to dark conditions, it was measured by irradiating light (red line plot graph), and samples maintaining dark conditions were compared to controls (black line plot graph). GR and GvTcR transcriptions were confirmed using PCR and the prepared primer sets. The bottom panel represents a bar graph comparing dark and light conditions at 7 h. n  = 4 biologically independent samples. b After three days of adaptation to light conditions, it was measured in dark conditions (blackline plot graph). It was compared through a red line plot graph maintaining light conditions. The bottom panel represents a bar graph comparing dark and light conditions at 7 h. n  = 4 biologically independent samples. All samples with multiple n’s are labeled with an error bar. The standard error is calculated by dividing the standard deviation by the square root of number of measurements.

The transcription level of the ABC transporter ATP-binding protein gene increased up to 8 times when transitioning from the light to the dark condition (Fig.  5b ). In the case of GvTcR, the mRNA level increased faster under dark conditions than under light conditions, and when dark conditions were maintained, no changes were observed over time. The transcription of GR slowly decreased as the light disappeared and we were rarely able to measure it after approximately 7 h. Consequently, the transcriptional level of GR was increased by light, and the transcriptional levels of GvTcR and ABC transporter ATP-binding protein genes were repressed during the initial phase of GR transcriptional increase compared to the results measured after 5 h. However, the transcription level of GvTcR and the ABC transporter ATP-binding protein gene was observed to increase under dark conditions. In contrast, the transcription level of GR decreased because the role of the photosystem was not expected in dark conditions. Comparing the transcript levels of GR and GvTcR after 5 h, the transcript levels of GR were measured to be approximately 3 to 4 times higher than those of GvTcR. It suggests that as the transcriptional level of GR comes to exceed that of GvTcR, the transcriptional level of GR increases for light-induced energy production, which simultaneously causes the energy used by GvTcR and the ABC transporter ATP-binding proteins to decrease to capture more of the through light-energy produced ATP for driving metabolic processes.

Globobacter rhodopsin (GR), identified as a light-induced proton pump, has also been shown to have an affinity for the transcriptional regulator GvTcR. As a result, the proton pump function of GR in the complex is strongly inhibited. Evidence was presented that this complex can also form in the native organism G. violaceus PCC7421 and that it can reciprocally regulate the expression of its components and ABC transporters, one of the targets of GvTcR, in a light-dependent manner. This study started from the idea that HTH-type transcriptional regulators can bind to GR. In G. violaceus PCC7421, GR acts as a photosystem for energy production and shows functional evolution in combination with various carotenoids 11 , 30 . GvTcR, capable of binding to GR, was obtained by exploring HTH-type transcription regulators, such as genes present in living organisms. Unlike KmtR and CmtR, which have similar sequences with GvTcR, GvTcR does not bind to metals and is assumed to be regulated by GR. This might be underlined by an evolutionary flow in which HTH-type transcription regulators express a defense mechanism against low-concentration harmful metals in the natural environment through light. The concentration of harmful metals is remarkably low, and the function of removal and avoidance can be achieved by effectively controlling them through light. The ABC transporter ATP binding protein and GvTcR genes that can be controlled with GvTcR were identified and controlled by interaction with GR (Figs.  3 , 4 ). Through structural and binding simulations, we identified two amino acids, R69 and K141, that are involved in the binding of GvTcR to GR and confirmed that these are critical sites. In addition, the GR R69A/K141A mutant was measured to have a 1000-fold weaker K D than GvTcR and a pull-down assay was performed to compare it to the gel electrophoresis results (Figure  S7 ). Cell lysates expressing GvTcR without His tag were run on GR, which showed an up-shifted band. For the GR R69A/K141A mutant, we flowed His-tagged GvTcR-expressing cell lysate to account for weaker binding and saw a band of GvTcR but no up-shifted band. In the case of PR, the band of GvTcR and the shifted band were not visible, suggesting that GvTcR does not bind to PR.

We observed that the binding of GR with GvTcR reduced pumping activity (Fig.  2f ), thereby replacing its function as a sensor through the photocycle measurement. The binding of GR to GvTcR results in the appearance of a slowed M-like intermediate. This suggests that a conformational change in the M-like intermediate limits the rate of SB deprotonation, and this conformational transition is the inward bending of the transmembrane helix C toward helix G as the water molecules rearrange along the proton potential channel 31 . GR binding to GvTcR involves R69 and K141, and these amino acids are present in intracellular loops 1 and 2 centered on helix C. This suggests that the movement of helix C is disrupted by bound GvTcR. For this reason, we propose that it affects the M-like intermediate and slows it down. In addition, R69 and K141 are critical for GvTcR binding, which in turn affects the uptake of proton. This would lead to the binding of GvTcR to membrane proteins, inhibiting the opportunity for gene regulation. GvTcR influences the proton transfer to an acceptor from the retinal Schiff base, hindering the proton pumping activity, and introducing a conformation change that extends the first conformation change when excited energy is applied to the sensor. Whether this conversion as a sensor can be regulated in G. violaceus PCC7421 was investigated using RT-PCR. Experiments in G. violaceus PCC7421 may affect carotenoid antenna pigments on GR. GR interactions with carotenoids such as salinixanthin and canthaxanthin (CAN) form a secondary chromophore. We presumed that increasing light absorption efficiency by forming a secondary chromophore would not significantly affect the binding of GR and GvTcR. In addition, there are limitations in controlling the expression of GR and GvTcR through carotenoid binding in the E. coli expression system; hence, further research is needed. In dark conditions, the mRNA level of GR, which serves as a photosystem, was increased with light exposure. It suggests cells respond by increasing GR transcription for energy production in light. The mRNA level of GR tended to increase by light irradiation; however, the mRNA level of the ABC transporter ATP-binding protein decreased. In the case of the light adaptation state to dark condition. In contrast, the mRNA level of the ABC transporter ATP-binding protein increased, and the transcription level of GR decreased. It suggests that GR regulates the mRNA level of ABC transporters through interaction with GvTcR to generate ATP through light and reduce the consumption of unnecessary ATP for biological reactions. The ABC transporter exports lipids, sterols, drugs, and a large variety of primary and secondary metabolites using ATP. The ABC transporter ATP-binding protein regulates the transcription level for energy production and accumulation, because its function is additive in the biological response for cell survival 14 . While light is being irradiated, the GR aids energy production and adjusts the accumulated energy efficiently to distribute it to various metabolic processes. GvTcR, which continuously increases the amount of self-regulation, is unnecessary energy consumption to cells. Therefore, the mechanisms regulated by GR can be seen as an evolutionary step to implement a GR-controlled mechanism for situations where metal ions cannot be combined. Following the light-induced increasing the mRNA level of GR, the mRNA level of GvTcR is suppressed and might be controlled to prevent unnecessary energy consumption. It is understood that sufficient energy accumulation occurs after light energy has been converted into chemical energy, after which the mRNA levels of GvTcR increase for use in various biological processes. It was also observed in the light adaptation state to dark conditions. In the case of the turned-off the light and the mRNA level was tracked, the mRNA level of GvTcR increased more rapidly than when initially inhibited by the expressed GR (Fig.  5 ). Interestingly, as shown in Fig.  5a , the mRNA level of GR and GvTcR increased meaningfully starting at 5 h. These results are considered the possibility that if the mRNA level is translated into protein expression, the expression of GR, which is responsible for converting light energy into ATP, may be increased under light conditions. In contrast, the transcription of the ATP-consuming ABC transporter ATP-binding protein may be downregulated. This suggests that GR also regulates the expression of GvTcR to lower the expression of ABC transporter ATP-binding proteins that use ATP for energy in organism. The light-responsive system increases the expression rate of GR, which functions as a proton transporter, and the amount of intracellular ATP increases, and the freed GvTcR increases the expression of GvTcR through self-regulation. The relative quantification of GR was measured to be approximately 4-fold higher than that of GvTcR. This is consistent with a steady increase in GvTcR expression over time, suggesting such a model (Fig.  6 ).

figure 6

The transcription of GR is increased in the presence of light, thereby suppressing GvTcR expression. The target genes of GvTcR, ABC transporter ATP binding protein, and self-regulation are suppressed and a sufficient number of GRs are present to maintain energy production function. Under dark conditions, the transcription of GR does not increase; however, the existing GRs regulate the gene expression of GvTcR.

Based on the model, The transcription of GvTcR is increased for use in various biological processes after converting light energy into chemical energy. Light-dependent transcriptional level regulation of proteins in living organisms provides clues to the circadian rhythm. To supply energy using light, the expression of photoreceptors is increased, which produces ATP and simultaneously suppresses the transcription of other proteins to prevent indiscriminate energy consumption. When a sufficient amount of energy is produced under light, it regulates the transcription of photoreceptors to control excessive energy production for use in various biological processes. In the absence of light, it is suggested to have formed an evolutionary circadian clock that can live in a harsh natural environment by using the produced energy for various biological processes. Interestingly, it is the effect of the presence or absence of light, as well as the presence or absence of GR itself. These results suggest that the gene regulatory function of GvTcR is affected by the presence of light yet is relatively more dependent on the binding of the GR itself. Further studies will be needed to characterize the structural features of GR and GvTcR in light and dark conditions.

In this study, we provided insights into GvTcR functionality, which is moderated by light via GR. GR plays an important role in ATP production as a photosystem and regulates transcriptional levels for energy accumulation. In the dark, the existing expressed GR binds with GvTcR and regulates the transcriptional level of the ABC transporter ATP-binding protein and GvTcR (Fig.  6 ). In the presence of light, the transcription level of GR is increased in the cell; thus, inhibiting the transcription of GvTcR and reducing the ABC transporter ATP-binding protein. As the transcription level of GR increases, energy is produced due to the increase in proton pumping activity during the inhibition of GvTcR through GR. It is considered to be the process of producing and accumulating energy in the presence of light while efficiently avoiding unnecessary energy consumption. GvTcR regulates the increase in transcription level of the ABC transporter ATP-binding protein and GvTcR for various bioreactions when sufficient energy is accumulated. It is suggested as part of a cyclic biological reaction process according to the presence or absence of light. From these results, the circadian clock process by which GR transcription is increased by light is challenging to explain. It is presumed to be modulated through certain receptors by light, and GR transcription is expected to occur through various processes. In addition, the possibility that the function of GvTcR affects the regulation of other genes and the two genes of this report should also be investigated. In-depth research on the biological meaning of regulating the finally regulated ABC-transporter ATP binding protein is needed. We have continuously studied and reported the function and role of GR in binding with carotenoids to form secondary chromophores. Studies on GRs regulating the transcriptional control of GvTcR suggest that the function of carotenoid-mediated secondary chromophores in live cells may provide a new direction for regulation. The regulation of GvTcR by carotenoid binding of GR requires further study.

Materials and methods

Cloning of gr and gvtcr.

Gloeobacter violaceus PCC 7421 rhodopsin (GR; accession no. NP_923144) and GvTcR (NCBI accession number: WP_011141437.1) were obtained through genomic DNA PCR using specific primers. Forward and reverse primers containing a hexahistidine tag at the C-terminus for GR were 5′- TACATATGTTGATGACCGTAT-3′ and 5′- GGGCGGCCGCTCAGTGATGATGGTGGTGATGGGAGAT-3′, respectively. Forward and reverse primers containing a hexahistidine tag at the C-terminus for GvTcR were 5′- ATCATATGGATGCGGACCA-3′ and 5′-TGCGGCCGCTTAGTGATGATGGTGGTGATGTGGCTGCTC-3′, respectively. The PCR fragments were introduced at the Nde I and Not I restriction enzyme sites for introduction into the pKA001 vector 32 .

GR and GvTcR co-expression plasmid construction

The GR and GvTcR genes with C-terminal hexahistidine tags were cloned into the pKA001 vector. GR has BamHI and XmaI , while GvTcR has NdeI and NotI restriction enzyme sites. Both genes were located under the lacUV5 promoter, and IPTG induced their expression. GR and GvTcR were sequentially arranged in the vector sequence. An additional ribosomal binding site (RBS) was generated between the GR stop codon and GvTcR start codon to improve GvTcR expression. Each GR and GvTcR fragment was amplified using PCR and the 5′-CGGATCCATGTTGATGAC-3′ (GR forward primer; BamHI), 5′- ATATCTCCTTCTTAAAGTTAAACAAACCCGGGTCAGTGATGATGGTGGTGATGGGAGATAAGAC-3′ (GR reverse primer; 6xHis + XmaI  + RBS), 5′- GGTTTGTTTAACTTTAAGAAGGAGATATCAtATGgatgcggacc-3′ (GvTcR forward primer; RBS + NdeI ), and 5′-GTGCGGCCgcttaGTGATGATGGTGGTGATGtggctgctcc-3′ (GvTcR reverse primer; 6xHis + NotI ) primers. After performing an overlap-extended PCR with the two generated gene fragments to obtain fragments linked to GR and GvTcR, pKA001 vector cloning was conducted using BamHI and NotI restriction enzymes and T4 ligase.

Sequence analysis and phylogenetic tree

The similarity of the amino acid sequence of GvTcR to that stored in the NCBI database was determined using BLAST-P. Multiple sequence alignments were constructed using MUSCLE 33 . The 2D structure of GvTcR was predicted using Jpred4 22 . The operons for several genomes of each bacterium containing photolyases were investigated using the NCBI GenBank database. Evolutionary history was inferred using the UPGMA method 34 . An optimal tree is shown. The tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method 35 . Evolutionary analyses were conducted using the MEGA-X software 36 .

Protein expression in E. coli

Further, pKA001-GR and pKA001-GvTcR were transformed into Escherichia coli UT5600, and single colonies were selected and grown in Luria-Bertani (LB) broth containing ampicillin (50 µg/mL) at 35 °C and 200 rpm overnight. After overnight culture, 1% of the total volume was transferred to a new broth, grown to an optical density (OD) of 0.5 and measured at 600 nm. Protein expression was induced by adding 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG; Duchefa Biochemie, Netherlands) and 7 µM all- trans -retinal (Sigma Aldrich, St. Louis, MO, USA) for 4 h at 35 °C. GvTcR expression was induced using IPTG alone. Cells were harvested by centrifugation for 15 min at 5,000 rpm and 4 °C.

Purification of rhodopsins

Harvested cells expressed with membrane protein were lysed via sonication with sonication buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.0) and ultracentrifuged for 1 h at 35,000 rpm and 4 °C (Beckman, Brea, CA, USA) at the Advanced Bio-Interface Core Research Facility, and pellets were resuspended in 1% n-dodecyl-β-d-maltopyranoside (DDM; Anatrace, Maumee, OH, USA) dissolved in sonication buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.0) overnight at 4 °C for solubilization. After solubilization, centrifugation was performed for 15 min at 20,000 rpm and Ni 2+ NTA agarose (Qiagen, Hilden, Germany) was added to the supernatant. The mixture was shaken gently for 4 h at 4 °C. The expressed rhodopsins were separated using affinity chromatography using wash buffer (25 mM imidazole, 0.02% DDM, 150 mM NaCl, 50 mM Tris-HCl, pH 7.0) and elution buffer (250 mM imidazole, 0.02% DDM, 150 mM NaCl, 50 mM Tris-HCl, pH 7.0). Purified rhodopsin was concentrated using an Amicon Ultra-4 10 K centrifugal filter tube (Millipore, Burlington, MA, USA). For GvTcR, cells were disrupted through sonication. After removing the cell debris through centrifugation (4000 rpm at 4 °C), the cell lysate was subjected to Ni 2+ -NTA agarose. GvTcR was eluted with sonication buffer containing 250 mM imidazole and subsequently concentrated in an Amicon Ultra-4 10 K centrifugal filter tube.

Absorption spectroscopy

Absorption spectra were measured using a UV-visible spectrophotometer (UV-2550; Shimadzu, Japan) and their values were analyzed using Origin 9.0.

Light-driven proton transport assay

The expressed cells were collected by centrifugation at 5000 × g for 15 min, suspended in pumping solution (10 mM NaCl, 10 mM MgSO 4 , and 10 µM CaCl 2 ), and centrifuged again at 4000 × g for 15 min (Eppendorf centrifuge 5810 R, Germany). The expressed whole cells were washed with a pumping solution for each measurement 37 . The cells were illuminated by a shortwave cutoff filter (>440 nm, Sigma Koki SCF-50S-44Y, Japan). The pH variation was monitored (Horiba pH meter F-71A, Japan), and data were recorded using the LAQUA Software Ver. 1.47 (Japan). Three measurements were performed for each sample to compare the degree of proton pumping and the average value was calculated.

Binding affinity was determined using isothermal titration calorimetry (ITC)

For ITC analysis 12 , 38 , wild-type and mutant GvTcR were completely replaced with sonication buffer containing 0.02% DDM using Amicon Ultra-4 10,000 MWCO centrifugal filter units. ITC analysis was performed using a MicroCal ITC200 instrument (Malvern Panalytical, UK). Data analysis was performed using the Origin-ITC software. Gene sequences in promoter regions that can bind GvTcR. Each sequence was inserted using the 5′-GGGCGCGCGGCGTCCAATCAAGCAGAAGGCACTTACGGAAGCAACTCGCT-3′, and 5′-CGGGGGACTTGACGGCGGCGCCCGGAAGTCATATAACTGTTTTTTTATATAAATTGCTGGTT-3′ primers.

The spectral shift upon GR and mutant binding to GvTcR

Purified GR and GvTcR were mixed in a 1:1 molar ratio and time-dependent absorption spectra were measured using a UV-2450 spectrometer. Purified GR mutant and GvTcR were mixed in a 1:1 molar ratio. Based on the complex formation ratio by isothermal titration calorimetry, a GR-GvTcR complex was formed via 1:1 binding. It was estimated that under these conditions about 60% of the total GR present was bound in a GR-GvTcR complex.

Time base kinetic experiment and ultra-kinetic

Light-induced absorption difference spectroscopy was performed to investigate the primary conformational changes of the purified proteins. The change in light-induced static absorption was measured using a Schinco spectrophotometer (Korea). Briefly, purified protein samples were kept in the dark for 15 min before the experiment, next, during 1 min of light illumination measurements were acquired every 800 ms for a full spectrum scan and 20 ms for a selected wavelength of interest. The same concentration of GR as HTH transcription factor protein and BSA was prepared in 50 mM Tris and 150 mM NaCl at pH 7.0. The average of each dataset was used for the fitting process. Based on the complex formation ratio by isothermal titration calorimetry, a GR-GvTcR complex was formed via 1:1 binding.

Reporter system

For the luciferase reporter system, we inserted the promoter DNA sequence into multiple cloning sites (MCS) of pGL4.10[luc2] by cloning with the restriction enzymes KpnI and XhoI . A promoter cloned vector and a vector cloned using GR and GvTcR were co-transformed into the reporter E. coli (BL21 DE3 strain). This was inoculated and grown at 37 °C and 200 rpm overnight and then incubated until an OD of 0.5 was achieved through 1% transferred cells. Ampicillin, IPTG, and All- trans retinal (when GR was included) were added to a 24-well plate, mixed with cells, and induction was conducted for 2 h. Cells were assessed using a luminometer (Berthold) and the Luciferase Assay System kit (E1500; Promega, Madison, WI, USA). For the fluorescent reporter system, GFP was introduced using NdeI and NotI into the pET28a vector. We co-transformed the vector created by introducing promoter sequences at BglII and XbaI , and the vector expressing GvTcR or GR to the reporter E.coli (BL21 DE3 strain). This was inoculated and grown at 37 °C and 200 rpm overnight, and then grown until an OD of 0.5% was achieved through 1% transferred cells. Ampicillin, IPTG, and All- trans retinal (when GR was included) were added to a 24-well plate, mixed with cells, and induction was conducted for 2 h. Cell fluorescence was measured using a 2300 EnSpire Multimode Plate Reader (PerkinElmer, Waltham, MA, USA). The promoter sequence use is as follows: Each sequence was inserted by 5′-GGGCGCGCGGCGTCCAAT CAAGCAGAAGGCACTTACGGAAGCAACTCGCT-3′ for the promoter of the ABC transporter ATP-binding protein and 5′-CGGGGGACTTGACGGCGGCGCCCGGAAGTCATATAACTGTTTTTT TATATAAATTGCTGGTT-3′ for the GvTcR promoter.

Real-time PCR

Gloeobacter violaceus PCC 7421 was obtained from the Culture Collection of Algae and was grown in a Z-medium under photoautotrophic conditions at 25 °C, 150 rpm. The light source was a fluorescent lamp (FL20SD) at an intensity of 10 µmol m −2  s −1 . G. violaceus PCC 7421 was adapted to dark conditions for 3 days. For the light-to-dark experiment, samples were prepared by adapting cells to light conditions. A sensitivity test was performed using a prepared primer set. 16s rRNA was used as endogenous control. The primer sequence is as follows. Forward primer: 5′-CCTGACGGTACCTGACGAAT-3′, Reverse primer: 5′-GGTTGGCTAGAGTGCGGTAG-3′. Samples were obtained every hour, depending on the presence or absence of light, according to each condition, and cDNA synthesis was performed immediately for RT-PCR. One-Step PrimeScript™ III RT-qPCR Mix (Takara, Japan) was used to synthesize cDNA. RT-PCR was performed using an Applied Biosystems 7500 Real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). The PCR reaction mixtures were prepared with 1.6 nM forward and reverse primers for each gene, 200 ng cDNA, and TOPreal™ SYBR Green qPCR 2X PreMIX (Enzynomics, Daejeon, Korea) in a total volume of 20 μL. The RT-PCR conditions were 95 °C for 10 min, followed by 30 cycles of 95 °C for 10 s, 53 °C for 1 min, and 97 °C for 2 min. The 16 s rRNA was used as endogenous control, and data was collected during the annealing step.

Statistics and reproducibility

In proton pumping experiments were performed at least three times. Data are shown as boxplot ± s.d. ( n    =   3). Absorption spectra data were fitted with multiple peak distribution (Gaussian) association curves, using Origin Pro 9.0. The fluorescent reporter system results were performed at n  = 15 biologically independent samples. The luciferase reporter system results were performed at n  = 8 biologically independent samples. Real-time PCR results were performed at n  = 4 biologically independent samples.

Data availability

All data supporting the findings of this study are available within the paper and its Supplementary Information. Fluorescent reporter system for transcriptional regulatory promoter identification vector (Addgene ID : 221817, 221816). The source data behind the graphs in the paper can be found in Supplementary Data  1 .

Braslavsky, S. E. In Photochromism Ch. 10 (eds. Dürr, H. & Bouas-Laurent, H.) 738–755 (Elsevier Science, Amsterdam). https://doi.org/10.1016/B978-044451322-9/50023-3 (2003).

Li, J., Li, G., Wang, H. & Wang Deng, X. Phytochrome signaling mechanisms. Arabidopsis Book 9 , e0148 (2011).

Article   PubMed   PubMed Central   Google Scholar  

Chuon, K. et al. Carotenoid binding in Gloeobacteria rhodopsin provides insights into divergent evolution of xanthorhodopsin types. Commun. Biol. 5 , 1–8 (2022).

Article   Google Scholar  

Zoltowski, B. D. & Gardner, K. H. Tripping the light fantastic: blue-light photoreceptors as examples of environmentally modulated protein-protein interactions. Biochemistry 50 , 4–16 (2011).

Article   CAS   PubMed   Google Scholar  

Govorunova, E. G., Sineshchekov, O. A., Li, H. & Spudich, J. L. Microbial rhodopsins: diversity, mechanisms, and optogenetic applications. Annu. Rev. Biochem. 86 , 845–872 (2017).

Article   CAS   PubMed   PubMed Central   Google Scholar  

Finkel, O. M., Béjà, O. & Belkin, S. Global abundance of microbial rhodopsins. ISME J. 7 , 448–451 (2013).

Pushkarev, A. et al. A distinct abundant group of microbial rhodopsins discovered using functional metagenomics. Nature 558 , 595–599 (2018).

Shim, J. et al. Heliorhodopsin helps photolyase to enhance the DNA repair capacity. Microbiol. Spectr. 0 , e02215–e02222 (2022).

Google Scholar  

Cho, S.-G. et al. Heliorhodopsin binds and regulates glutamine synthetase activity. PLOS Biol. 20 , e3001817 (2022).

Choi, A. R., Shi, L., Brown, L. S. & Jung, K.-H. Cyanobacterial light-driven proton pump, gloeobacter rhodopsin: complementarity between rhodopsin-based energy production and photosynthesis. PLoS ONE 9 , e110643 (2014).

Chuon, K. et al. The role of carotenoids in proton-pumping rhodopsin as a primitive solar energy conversion system. J. Photochem. Photobiol. B: Biol. 221 , 112241 (2021).

Article   CAS   Google Scholar  

Shim, J. et al. The binding of secondary chromophore for thermally stable rhodopsin makes more stable with temperature. Protein Sci. 31 , e4386 (2022).

Locher, K. P. Structure and mechanism of ATP-binding cassette transporters. Philos. Trans. R. Soc. Lond. B: Biol. Sci. 364 , 239–245 (2009).

Wang, B., Dukarevich, M., Sun, E. I., Yen, M. R. & Saier, M. H. Membrane porters of ATP-binding cassette transport systems are polyphyletic. J. Membr. Biol. 231 , 1–10 (2009).

Ye, Z., Lu, Y. & Wu, T. The impact of ATP-binding cassette transporters on metabolic diseases. Nutr. Metab. 17 , 61 (2020).

Xiong, J., Feng, J., Yuan, D., Zhou, J. & Miao, W. Tracing the structural evolution of eukaryotic ATP binding cassette transporter superfamily. Sci. Rep. 5 , 16724 (2015).

Busenlehner, L. S., Pennella, M. A. & Giedroc, D. P. The SmtB/ArsR family of metalloregulatory transcriptional repressors: Structural insights into prokaryotic metal resistance. FEMS Microbiol. Rev. 27 , 131–143 (2003).

Park, H. et al. A LysR-type transcriptional regulator LcrX is involved in virulence, biofilm formation, swimming motility, siderophore secretion, and growth in sugar sources in Xanthomonas axonopodis Pv. glycines. Front. Plant Sci. 10 , 1657 (2020).

Brown, N. L., Stoyanov, J. V., Kidd, S. P. & Hobman, J. L. The MerR family of transcriptional regulators. FEMS Microbiol. Rev. 27 , 145–163 (2003).

Roy, R., Samanta, S., Patra, S., Mahato, N. K. & Saha, R. P. In silico identification and characterization of sensory motifs in the transcriptional regulators of the ArsR-SmtB family. Metallomics 10 , 1476–1500 (2018).

Das, S., Dash, H. R. & Chakraborty, J. Genetic basis and importance of metal resistant genes in bacteria for bioremediation of contaminated environments with toxic metal pollutants. Appl. Microbiol. Biotechnol. 100 , 2967–2984 (2016).

Drozdetskiy, A., Cole, C., Procter, J. & Barton, G. J. JPred4: a protein secondary structure prediction server. Nucleic Acids Res. 43 , W389–W394 (2015).

Rohs, R. et al. Origins of specificity in protein-DNA recognition. Annu. Rev. Biochem. 79 , 233–269 (2010).

Balashov, S. P. et al. Reconstitution of gloeobacter rhodopsin with echinenone: role of the 4-keto group. Biochemistry 49 , 9792–9799 (2010).

Suryawanshi, V. D., Walekar, L. S., Gore, A. H., Anbhule, P. V. & Kolekar, G. B. Spectroscopic analysis on the binding interaction of biologically active pyrimidine derivative with bovine serum albumin. J. Pharm. Anal. 6 , 56–63 (2016).

Article   PubMed   Google Scholar  

Salis, H. M., Mirsky, E. A. & Voigt, C. A. Automated design of synthetic ribosome binding sites to precisely control protein expression. Nat. Biotechnol. 27 , 946–950 (2009).

Desta, I. T., Porter, K. A., Xia, B., Kozakov, D. & Vajda, S. Performance and its limits in rigid body protein-protein docking. Structure 28 , 1071–1081.e3 (2020).

Dinger, M. C. & Beck-Sickinger, A. G. The first reporter gene assay on living cells: green fluorescent protein as reporter gene for the investigation of Gi-protein coupled receptors. Mol. Biotechnol. 21 , 9–18 (2002).

Imasheva, E. S., Balashov, S. P., Choi, A. R., Jung, K.-H. & Lanyi, J. K. Reconstitution of gloeobacter violaceus rhodopsin with a light-harvesting carotenoid antenna. Biochemistry 48 , 10948–10955 (2009).

Chuon, K. et al. Assembly of natively synthesized dual chromophores into functional actinorhodopsin. Front. Microbiol. 12 , 652328 (2021).

Nango, E. et al. A three-dimensional movie of structural changes in bacteriorhodopsin. Science 354 , 1552–1557 (2016).

Pushkarev, A. et al. The use of a chimeric rhodopsin vector for the detection of new proteorhodopsins based on color. Front. Microbiol. 9 , 439 (2018).

Madeira, F. et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 47 , W636–W641 (2019).

Sneath, P. H. A. & Sokal, R. R. Numerical taxonomy. The principles and practice of numerical classification. Numerical Taxonomy. the Principles and Practice of Numerical Classification (1973).

Zuckerkandl, E. & Pauling, L. in Evolving Genes and Proteins 97–166 (Elsevier, 1965) https://doi.org/10.1016/B978-1-4832-2734-4.50017-6 .

Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35 , 1547–1549 (2018).

Shim, J. et al. Discovery of a microbial rhodopsin that is the most stable in extreme environments. iScience 24 , 102620 (2021).

Sudo, Y. et al. Importance of specific hydrogen bonds of archaeal rhodopsins for the binding to the transducer protein. J. Mol. Biol. 357 , 1274–1282 (2006).

Download references

Acknowledgements

This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) grant funded by the Ministry of Science and ICT (MSIT, Grant No: RS-2023-00208633). This research was supported by Basic Science Institute (National research Facilities and Equipment Center) grant funded by the MSIT (Grant No: 2020R1A6C101A192.

Author information

Jin-gon Shim

Present address: Pharmacology Department, Northwestern University Feinberg School of Medicine, Chicago, IL, USA

Authors and Affiliations

Department of Life Science, Sogang University, Seoul, South Korea

Jin-gon Shim, Kimleng Chuon, Ji‐Hyun Kim, Sang-ji Lee, Myung-chul Song, Shin-Gyu Cho, Chenda Hour & Kwang-Hwan Jung

Research Institute for Basic Science, Sogang University, Seoul, Korea

Myung-chul Song & Shin-Gyu Cho

You can also search for this author in PubMed   Google Scholar

Contributions

J.G.S. conceived and performed the experiments, wrote the manuscript, and secured funding. K.C., J.H.K, S.J.L, M.C.S., S.G.C., and C.H. provided expertise and feedback. J.G.S. and K.H.J. prepared the manuscript with contributions from all authors.

Corresponding author

Correspondence to Kwang-Hwan Jung .

Ethics declarations

Competing interests.

The authors declare no competing interests.

Peer review

Peer review information.

Communications Biology thanks all the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editors: Xiaoling Xu and Laura Rodríguez Pérez.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary information, description of additional supplementary files, supplementary data 1, reporting-summary., rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ .

Reprints and permissions

About this article

Cite this article.

Shim, Jg., Chuon, K., Kim, J. et al. Proton-pumping photoreceptor controls expression of ABC transporter by regulating transcription factor through light. Commun Biol 7 , 789 (2024). https://doi.org/10.1038/s42003-024-06471-4

Download citation

Received : 11 December 2023

Accepted : 19 June 2024

Published : 29 June 2024

DOI : https://doi.org/10.1038/s42003-024-06471-4

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

By submitting a comment you agree to abide by our Terms and Community Guidelines . If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Quick links

  • Explore articles by subject
  • Guide to authors
  • Editorial policies

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

method for titration experiment

IMAGES

  1. What is Titration in Chemistry?

    method for titration experiment

  2. Titration Photo

    method for titration experiment

  3. What is Titration and How is it Done?

    method for titration experiment

  4. What is Titration and How is it Done?

    method for titration experiment

  5. Titration Process

    method for titration experiment

  6. Vintage titrations: sulfur dioxide concentrations in wine

    method for titration experiment

VIDEO

  1. How to perform titration experiment part 1#viral #chemistry #shorts #exam #titration

  2. Lec 3

  3. Standardizing A Titrant For Titration Experiments #titration #chemistry #stoichiometry

  4. Titration with Big Manny

  5. Problems on double titration

  6. Unit 4.6

COMMENTS

  1. 21.17: Titration Experiment

    A titration is an experiment where a volume of a solution of known concentration is added to a volume of another solution in order to determine its concentration. Many titrations are acid-base neutralization reactions, though other types of titrations can also be performed. In order to perform an acid-base titration, the chemist must have a way ...

  2. Titrating sodium hydroxide with hydrochloric acid

    Stage 1. Using a small funnel, pour a few cubic centimetres of 0.4 M hydrochloric acid into the burette, with the tap open and a beaker under the open tap. Once the tip of the burette is full of solution, close the tap and add more solution up to the zero mark. (Do not reuse the acid in the beaker - this should be rinsed down the sink.)

  3. Titration

    Titration. Titration is the slow addition of one solution of a known concentration (called a titrant) to a known volume of another solution of unknown concentration until the reaction reaches neutralization, which is often indicated by a color change. The solution called the titrant must satisfy the necessary requirements to be a primary or ...

  4. How to Perform a Titration (with Pictures)

    Swirl the water around a few times before opening the stopcock and allowing it to drain. [2] Repeat the rinsing process at least 3 times with water to completely clean your burette. After you've rinsed the burette with water, perform the same rinsing process at least 2 times with your analyte. 3.

  5. 7.2: Lab

    pH Titrations. In a pH titration you measure the pH as a function of the volume of titrant added and determine the equivalence point as the point in where there is an inflection in the slope of the curve. Figure 7.2.2 7.2. 2 shows the four common types of titrations. Initially the pH is that of the pure analyte.

  6. Titration Tutorial: Tips & Tricks for Titrating

    What is Titration? Titration is a method commonly used in chemistry to figure out the amount of a chemical in a solution. This chemical is called the titrand. ... There are many different types of indicators used in titration experiments. Which indicator is used depends on the chemistry of the reaction taking place between the titrand and the ...

  7. Simple titration

    We recommend that 14-16 students complete Level 1 of the screen experiment, while older students can progress to Levels 2, 3 and 4. The screen experiments frame the titration procedure with a real-world scenario to foster an interest in chemistry careers and contextualise their learning. This content is provided by YouTube.

  8. Lesson Explainer: Titration Experiments

    Lesson Explainer: Titration Experiments. In this explainer, we will learn how to describe acid-base titration methods and their use in determining acid and base concentrations. When we want to determine the concentration of an acid or a base, we can perform a titration experiment. In a titration experiment, a solution with a known ...

  9. Acid-base titrations (video)

    Acid-base titrations. In a titration, a solution of known concentration (the titrant) is added to a solution of the substance being studied (the analyte). In an acid-base titration, the titrant is a strong base or a strong acid, and the analyte is an acid or a base, respectively. The point in a titration when the titrant and analyte are ...

  10. Titration

    The titration screen experiment is a helpful resource to support students to work through the calculations. ... titration as a method to prepare solutions of soluble salts and to determine relative and actual concentrations of solutions of acids/alkalis; PRACTICAL: Titration of a strong acid against a strong base using an indicator ...

  11. How To Carry Out a Titration Experiment

    A titration experiment is the gradual adding of a known concentration of a reagent, called a titrant, to an unknown concentration of an analyte (the substance being analysed) until an endpoint is reached. Titration is one of the classic experiments in chemistry, and it's done by most students at school. Usually, chemical indicators that change colour are used to determine the endpoint of a ...

  12. What is a Titration and how is it performed?

    In this chemistry tutorial video, we describe the correct method one would use to perform a titration. This includes the methods used to remove bubbles from ...

  13. Titration of hydrochloric acid with sodium hydroxide

    Note we have to end titration at first sight of color change, before color gets saturated. solutions used. To perform titration we will need titrant - 0.2 M or 0.1 M sodium hydroxide solution, indicator - phenolphthalein solution and some amount of distilled water to dilute hydrochloric acid sample. procedure

  14. Titration and calculations Acid-alkali titrations

    Titration is a method used to prepare salts if the reactants are soluble. Concentration and volumes of reactants can be calculated from titrations. Part of Chemistry (Single Science) Acids, bases ...

  15. How to Write a Lab Report About Titration

    Draw a table to represent the results of your titration. It is customary to write the final burette volume in the first row, the initial burette volume in the second row and the titre in the third row. The titre is calculated by subtracting the initial volume from the final volume. To indicate precision, write all your results in cubic ...

  16. Acid-Base Titrations

    Acid-Base Titrations. Acid-Base titrations are usually used to find the amount of a known acidic or basic substance through acid base reactions. The analyte (titrand) is the solution with an unknown molarity. The reagent (titrant) is the solution with a known molarity that will react with the analyte.

  17. Performing a Titration & Volumetric Analysis

    REQUIRED PRACTICAL 1. Performing the Titration. The key piece of equipment used in the titration is the burette; Burettes are usually marked to a precision of 0.10 cm 3. Since they are analogue instruments, the uncertainty is recorded to half the smallest marking, in other words to ±0.05 cm 3 The end point or equivalence point occurs when the two solutions have reacted completely and is shown ...

  18. Method

    Learn about the titration technique through a practical experiment to determine the reacting volumes and concentration of solutions of acid and alkali.

  19. Practical activity

    This is an outline of the required steps to undertake one of these methods. ... end-point close end-point In a titration, ... similar result if it is taken many times over in the same experiment.

  20. A thermometric titration

    In this thermometric titration, students can determine the end-point of the titration using the highest temperature recorded during the experiment. Using a pipette and safety filler, transfer 20 cm 3 (or 25 cm 3) of the sodium hydroxide solution into the cup, and measure the steady temperature. Using the burette, add a small portion (3-5 cm 3 ...

  21. Neutralisation (titration)

    Method. use a pipette and pipette filler to add 25 ml of sodium hydroxide to a clean conical flask. add a few drops of phenolphthalein indicator and place the conical flask on a white tile. fill the burette with hydrochloric acid and record the starting volume. slowly open the tap of the burette, and add the acid to the conical flask, swirling ...

  22. 7.18: Titration Experiment

    A titration is an experiment where a volume of a solution of known concentration is added to a volume of another solution in order to determine its concentration. Many titrations are acid-base neutralization reactions, though other types of titrations can also be performed. In order to perform an acid-base titration, the chemist must have a way ...

  23. A Titration Experiment Can Be Used To Determine The

    Experiment Titration is an analytical method used to determine the exact amount of a substance by reacting that substance with a known amount of another substance. acid solution (of known concentration) required to neutralize it. The purpose of the titration is the detection of the equivalence point, the point at which chemically equivalent ...

  24. Structural characterization of macro domain-containing Thoeris ...

    Isothermal titration calorimetry (ITC) ... (47 μM) with ADPR (1 mM) at 4°C for 1 hour. The data in (A), (B), and (G) are representative of three independent experiments (using the same protein batches). ... Although both PcThsA Macro and EcThsA Macro were purified using the same method with imidazole-containing buffers, ...

  25. Quantitative chemistry

    Titration practical experiment . Determining the reacting volumes of solutions of a strong acid and a strong alkali by titration. In this practical, you will use appropriate apparatus to make and ...

  26. Real-Time Monitoring of Photoinduced pH Jumps by In Situ Rapid-Scan EPR

    CW EPR experiments allow determination of the shift in the isotropic hyperfine splitting at constant pH values (Figure 1c), but they cannot cover the overall process of ionization in a time-resolved manner. The recorded titration curve, however, can be used as a calibration for time-resolved rapid-scan measurements.

  27. PDF A biosensor-based phage display selection method for ...

    Diepenbeek, Belgium) respectively. The FOx biosensor-based method also allows to monitor the immobilization of the target and the binding of phage to it. However, all these methods still take weeks to perform multiple rounds, include time consuming steps like phage purification and titration, and use considerable quantities of the purified target.

  28. Proton-pumping photoreceptor controls expression of ABC ...

    d Isothermal titration calorimetry (ITC) analysis shows the binding results for GvTcR with DNA fragments of promoter regions. The top and bottom panels show the raw data and the enthalpy changes.