e.coli thesis

Open Access is an initiative that aims to make scientific research freely available to all. To date our community has made over 100 million downloads. It’s based on principles of collaboration, unobstructed discovery, and, most importantly, scientific progression. As PhD students, we found it difficult to access the research we needed, so we decided to create a new Open Access publisher that levels the playing field for scientists across the world. How? By making research easy to access, and puts the academic needs of the researchers before the business interests of publishers.

We are a community of more than 103,000 authors and editors from 3,291 institutions spanning 160 countries, including Nobel Prize winners and some of the world’s most-cited researchers. Publishing on IntechOpen allows authors to earn citations and find new collaborators, meaning more people see your work not only from your own field of study, but from other related fields too.

Brief introduction to this section that descibes Open Access especially from an IntechOpen perspective

Want to get in touch? Contact our London head office or media team here

Our team is growing all the time, so we’re always on the lookout for smart people who want to help us reshape the world of scientific publishing.

Home > Books > Escherichia coli - Recent Advances on Physiology, Pathogenesis and Biotechnological Applications

Isolation and Characterization of Escherichia coli from Animals, Humans, and Environment

Submitted: 28 April 2016 Reviewed: 09 January 2017 Published: 12 July 2017

DOI: 10.5772/67390

Cite this chapter

There are two ways to cite this chapter:

From the Edited Volume

Escherichia coli - Recent Advances on Physiology, Pathogenesis and Biotechnological Applications

Edited by Amidou Samie

To purchase hard copies of this book, please contact the representative in India: CBS Publishers & Distributors Pvt. Ltd. www.cbspd.com | [email protected]

Chapter metrics overview

7,896 Chapter Downloads

Impact of this chapter

Total Chapter Downloads on intechopen.com

Total Chapter Views on intechopen.com

Working on a diverse species of bacteria that have hundreds of pathotypes representing hundreds of strains and many closely related family members is a challenge. Appropriate research design is required not only to achieve valid desired outcome but also to minimize the use of resources, including time to outcome and intervention. This chapter outlines basics of Escherichia coli isolation and characterization strategies that can assist in research designing that matches the set objectives. Types of samples to be collected, collection and storage strategies, and processing of samples are described. Different approaches to isolation, confirmation and concentration of various E. coli strains are summarized in this chapter. Characterization and typing of E. coli isolates by biochemical, serological, and molecular methods have been explained so that an appropriate choice is made to suite a specific E. coli strain/pathotype. Some clues on sample and isolate preservation for future use are outlined, and general precautions regarding E. coli handling are also presented to the researcher to avoid improper planning and execution of E. coli-related research. Given different options, the best E. coli research design, however, should try as much as possible to shorten the length of time to outcomes.

• β-glucuronidase
• Enterobacteriaceae
• cryoprotectant

Author Information

Athumani msalale lupindu *.

• Department of Veterinary Medicine and Public Health, College of Veterinary and Medical Sciences, Sokoine University of Agriculture, Morogoro, Tanzania

*Address all correspondence to: [email protected]

1. Introduction

Escherichia coli is Gram-negative, facultative anaerobic, and rod-shaped bacterium of the genus Escherichia . This is a large diverse group of bacteria commonly found in the lower intestine of warm-blooded organisms. Most of them are commensals inhabiting the lower gastrointestinal tract (GIT) of mammals. The other strains that are pathogenic are categorized into two groups, according to the site of infection. E . coli that infect and cause disease syndromes in the gastrointestinal tract are intestinal pathogenic E . coli (IPEC). Those that cause disease syndromes in systems other than gastrointestinal tract are called extra-intestinal E . coli (EXPEC). The commensal group form part of gut microbiota and is used as indicator bacteria for fecal contamination.

Pathogenic E . coli group consist of many strains, which for simplicity, can be grouped according to the virulence factors they possess or pathological effects they cause. The intestinal pathogenic E . coli include enterotoxigenic E . coli (ETEC), enteroaggregative E . coli (EAEC), enteropathogenic E . coli (EPEC), enteroinvasive E . coli (EIEC), diffusely adherent E . coli (DAEC), and verocytotoxigenic E . coli (VTEC) according to O’Sullivan et al. [ 24 ]. Extra-intestinal pathogenic E . coli includes uropathogenic E . coli (UPEC), neonatal meningitis-associated E . coli (NMEC), and sepsis-causing E . coli (SEPEC) [ 1 ].

Most pathogenic E . coli are transmitted by fecal-oral route from food materials, water, animals, and environment. Depending on the pathotype and the system, E . coli infection may cause a range of syndromes including watery, mucoid, or bloody diarrhea; abdominal cramps; urinary tract infection syndromes; and meningitis. Complications to pathogenic E . coli infection may lead to hemorrhagic uremic syndrome (HUS). These syndromes have been reported as food poisoning outbreak, travel-related illness, or animal or contaminated environment contact-related diseases. Global E . coli -related morbidities and mortalities are high. The estimates for the year 2010 show that there were 321,969,086 cases of E . coli food-borne illness which is 16.1% of global food-borne diseases. Also there were 196,617 deaths attributable to E . coli -related food-borne poisoning which is 0.02% of global mortalities due to food poisoning [ 2 ]. This situation calls for regular and continuous investigations to diagnose, treat, and prevent E . coli -related diseases.

Inappropriate planning of research due to lack of knowledge may lead to undesired outcomes. For instance, if one aims at assessing the magnitude of shading of diarrheagenic E . coli in cattle feces, he or she may end up with underestimated results if he or she chooses to use sorbitol MacConkey agar as a screening media because not all diarrheagenic E . coli are sorbitol fermenters. Likewise, if one is looking for E . coli O157:H7 in a sample, the use of media that discriminate bacteria according to the presence of β-glucuronidase activities may lead to missing the desired outcome since E . coli O157:H7 do not possess such an enzyme. This chapter, therefore, outlines approaches to isolate and characterize E . coli from animals, humans, and the environment so that planning and implementation of E . coli -related research can match the set objectives and desired outcome.

2. Collection and storage of sample for E . coli isolation

2.1. sample collection.

E . coli predominantly inhabit the gastrointestinal tract of mammals and are shed to the environment through feces. The feces from mammals can be collected for the purpose of E . coli isolation. In this case, fresh fecal material from individual humans or animals can be used. Dry or sunburnt fecal samples may lead to false negative results. Shading of E . coli in feces makes this microorganism abundantly available in the environment. As a result, E . coli can be recovered from water, soil, contaminated food material, and surfaces.

Sampling of the soil for isolation of E . coli requires taking the sample 2–5 cm beneath the surface. Top soils may contain dead bacteria. Water samples can be collected for E . coli detection. E . coli can also be isolated from contaminated surfaces of both animate and inanimate materials. Animate surfaces include human or animal body surface. Food surfaces or working structures such as table, knives, and clothes can be a good source of E . coli . Food surfaces such as meat, eggs, or fish can be used to isolate E . coli , depending on the objective of the study. Animal fecal sample can be taken from the rectum (large animals) or fresh droppings can be collected by fingers of a gloved hand. Human stool can be put in a container with a stopper. Water samples can be collected by different methods according to nature of the water body. Still surface can be collected by hand deep method, whereas flowing water sample collection requires depth-and-width-integrating methods. In this type of water body, for example, a stream, 5–10, or more samples are collected across the vertical depth and width [ 3 ]. Samples from surfaces such as hide, table, knife, and the likes can be obtained by sweeping a buffered peptone water with premoistened swabs or sponge on the sampling surface in a Z-pattern [ 4 ]. The sponge or swabs that covers approximately 400–1000 cm 2 are then put in 100 ml of tryptic soya broth for further processing.

2.2. Sample storage

Samples for E . coli isolation are best processed right after collection, normally within 24 h. This includes inoculation into enrichment or inoculation onto solid culture media. When situation does not allow, a sample can be stored at low temperatures that restrict further cell division, but at the same time, allows survival of the bacteria. Surface water samples for E . coli isolation stored at below 10°C, but not freezing, can give comparably good results for up to 48 h after collection [ 5 ].

Sometimes analysis of fecal samples immediately after collection is impractical due to temporal and spatial challenges or assessment of old samples can be a requirement. In this case, fecal/stool samples should be stored for later laboratory isolation or old samples that were appropriately stored are recalled. Fecal samples will maintain E . coli population density, clonal characteristics, and diversity as fresh samples when stored in glycerol broth at lower temperatures than −70°C for 30 days up to 1 year. The fecal sample may form 10% of final concentration in 10% glycerol broth. However, storage of this sample at −20°C for the same time period will lead to a decrease in bacteria population density but increased diversity [ 6 , 7 ]. Moreover, samples stored in glycerol broth will have more similar E . coli isolates to isolates from the fresh original sample than those from samples stored without mixing with glycerol, and if samples are repeatedly thawed, then addition of glycerol broth is recommended. Pure samples stored for a long time without glycerol lead to decrease in E . coli number [ 6 ]. Therefore, longer storage of fecal samples without appropriate processing may lead to inaccurate results.

3. Isolation of E . coli and quality control

3.1. isolation of e . coli.

Different options are available for the isolation of E . coli . The choice depends on target strain and objective of isolation. The ability to ferment lactose gives an option to use MacConkey agar to discriminate E . coli from other nonlactose fermenting coliforms from fecal, stool, food, water, and soil samples. Sample suspension (for solid samples) is made at any concentration, for example, 5% in normal saline or phosphate buffer solution and inoculated onto MacConkey agar followed by 18–24 h incubation at 37°C. Pink, round medium-sized colonies are picked as E . coli suspect colonies. All E . coli strains can be captured on MacConkey agar, and this approach gives a wide spectrum of strains to work on. Incubation of inoculated culture media at 45°C selects for thermophilic E . coli strains.

The concentration of sample suspension may be set at different levels such as 1 g of solid sample in 19 ml of normal saline or phosphate buffer solution (5%), 1 g in 9 ml (10%) or 1 g in 4 ml of diluent (20%). However, the concentration of sample suspension will affect the number of colonies on the culture plate. This is well evidenced in bacteria count procedures whereby higher dilution, like 10 5 , will give lower number of bacteria than low dilutions, for example, 10 1 . This is because the bacteria growth rate depends on initial cell density in the sample [ 8 ].

Sample suspension can be enriched by 24 h incubation at 37°C in nondifferential broth such as Muller-Hinton or nutrient broth. This procedure will allow multiplication of E . coli and hence increase the chance of E . coli isolation especially when infrequent strains, such as pathogens, are the target. The generation (doubling) time for E . coli at 37°C incubation is 17–18 min [ 8 ], therefore, in 18–24 h incubation there will be 60–80 E . coli cell generations. However, clonal variability will decrease when samples are enriched because same bacteria increase in number. Therefore, this procedure is suitable when the research aims at a mere presence of a single specific strain and not its variants.

The weight of the sample and the volume of diluent used in making the sample suspension may affect the probability of bacteria recovery. Large sample weight normally increases the sensitivity of the isolation procedure. For example, in E . coli studies to isolate nonsorbitol-fermenting Shiga toxin-producing E . coli (NSF STEC) whereby E . coli broth was used to enrich fecal samples, different prevalence measure was obtained. When 10 g of sample was suspended in 90 ml of E . coli broth, the prevalence of Shiga toxin-producing E . coli (STEC) obtained was 1.3% [ 9 ], while the suspension of 20 g in 180 ml of same diluent resulted into a prevalence 11.1% NSF STEC [ 10 ].

Purification of E . coli colonies can be done in nondifferential media such as blood or nutrient agars. Depending on the degree of colony density, a series of inoculations can be desired until pure, single, or solitary colonies are obtained.

3.2. Quality control

These are procedures undertaken to validate the accuracy of the bacteria isolates. Among the measures of quality control in isolation of E . coli include incubation of uninoculated media plates at 37°C overnight. The media plates should have no microbial growth after incubation. This will ensure that the isolates obtained after inoculation come from the samples and not due to contamination. Moreover, uninoculated media plate should be incubated simultaneously with inoculated media plates. Use of reference positive controls strains, e.g. E . coli ATCC 25922, will also help to ensure the isolates are the targeted bacteria.

For water samples, quality control measures may involve the use of blank and sample replicates. The true samples and the blanks are simultaneously incubated. The blank sample will tell that the sampling equipment has not been contaminated. The replicate results will assess the presence of variation for which explanations should be sorted out.

4. Confirmation of E . coli isolates

Confirmation of E . coli isolates can be done by biochemical, enzymatic, or molecular methods. The choice of the method depends on many factors including availability of resources. The confirmation methods include biochemical methods, such as IMViC and Analytical Profile Index 20E (API 20E) systems, enzymatic methods, for example, use of brilliance E . coli agar or Petrifilm Select E . coli count plate, and molecular techniques such as MALD-TOF.

4.1. IMViC tests

E . coli isolates can be confirmed biochemically by the use of a traditional method called IMViC tests. This is a set of four tests that are used to differentiate members of the family Enterobacteriaceae. IMViC is an abbreviation that stands for the Indole, Methyl red, Voges-Proskauer, and Citrate utilization tests. In Indole test, the bacteria are tested for their ability to produce indole from tryptophan (amino acid) using the enzyme tryptophanase.

The indole reacts with the aldehyde in the Kovac’s reagent to give a red or a pink ring at the top of the tube. Peptone water in a tube, which contains tryptophan, is inoculated with bacteria isolate to be tested. The mixture is incubated overnight at 37°C. Then, a few drops of Kovac’s reagent are added to the mixture and formation of a red or a pink colored ring at the top is a positive reaction. E . coli are indole-positive bacteria.

Methyl red test detects the ability of a bacterium to produce acid from glucose fermentation. Methyl red, a pH indicator, remains red in color at a pH less or equal to 4.4. The bacterium to be tested is inoculated into glucose phosphate (MRVP) broth, which contains glucose and a phosphate buffer and incubated at 37°C for 48 h. Three to five drops of MR reagent are added to the tube. Red color development is a positive reaction that occurs when the bacteria have produced enough acid to neutralize the phosphate buffer. Yellow discoloration occurs to MR-negative bacteria. E . coli are MR-positive bacteria.

Voges-Proskauer test is used to detect the presence of acetoin in the bacteria-containing media. Acetoin is oxidized to diacetyl in the presence of air and sodium hydroxide. Diacetyl, in the presence of alpha-naphthol, reacts with guanidine to produce red color. In order to perform VP test, the test bacterium is inoculated into glucose phosphate (MRVP) broth in a tube and incubated for 72 h.

Addition of 15 drops of alpha-naphthol to the test broth is followed by shaking. Then add five drops of 40% potassium hydroxide (KOH) to the broth and shake well. Allow the tube to stand for 15 min to see a positive red discoloration, after 1 h of no color change the isolate is categorized as VP negative. E . coli is VP negative.

Citrate utilization test detects the ability of the bacteria to use citrate as its sole source of carbon and energy. Citrate agar media contains a pH indicator called bromthymol blue. The agar media changes from green to blue at an alkaline pH. Streak a loopful of bacteria onto a citrate agar slant without stabbing the butt and incubate at 37°C for 24 h with a loose cap. Citrate in the media breaks down to oxaloacetate and acetate due to action of an enzyme citritase. Oxaloacetate is further broken down to pyruvate and CO 2 . Production of Na 2 CO 3 from sodium citrate changes the media into alkaline pH, and hence color change from green to blue. Blue color formation is a positive reaction, whereas the slant remaining green colored is a feature for negative test. E . coli is citrate negative.

This conventional IMViC test method gives results ( Table 1 ) that are similar to an agar plate IMViC method [ 11 ]. E . coli and Proteus vulgaris show the same IMViC pattern, but Proteus spp. are lactose-negative, motile, and show swarming behavior.

Table 1.

MViC test results of some members of family Enterobacteriaceae (Adapted from Powers and Latt [ 11 ]).

4.2. The API 20E system

Analytical Profile Index 20E is a set of biochemical tests specific for differentiating between members of the Gram-negative bacterial family Enterobacteriaceae. It is used for rapid identification of already known bacteria. API 20E system is made up of 20 small reaction tubes that contain dehydrated substrates for detection of the enzymatic fermentation of sugars by the test isolates. This fermentation occurs during incubation, and the resulting pH change is detected by an indicator. It is important to confirm that the test culture is of an Enterobacteriaceae first, by doing a quick oxidase test. Enterobacteriaceae are oxidase negative.

Inoculate the suspension of a pure culture into each of the 20 reaction tubes and Incubate the tray at 37°C for 18–24 h. You can read the color change in some compartments right after incubation, but some may require additional reagents. Mark each test as positive or negative on the lid of the tray and score them. Add up the scores, the maximum score being seven, to get a 7-digit code that is used to identify the bacteria by using the online database.

4.3. Enzymatic activities

Strict selective media that check for specific enzymatic activities in E . coli can be used to confirm E . coli isolates. For instance, brilliance E . coli agar or Petrifilm Select E . coli count plate can be used to check for presence and activity of β-glucuronidase enzyme. Beta-glucuronidase enzyme, which is specific to E . coli , cleaves glucuronide substrate resulting in purple and blue-green colonies in Brilliance E . coli agar and Petrifilm E . coli Select count plates, respectively. Non- E . coli coliforms have ß-galactosidase only, which enable them to break down lactose, whereas most of E . coli have both β-galactosidase and β-glucuronidase. However, E . coli O157 are glucuronidase negative; therefore, these media are not appropriate for initial screening of E . coli population but can be used to differentiate E . coli O157 from confirmed E . coli population.

4.4. MALD-TOF mass spectrometry

Matrix-Assisted Laser Desorption/Ionization Time-of-Flight (MALD-TOF) mass spectrometry is a rapid and accurate method for microorganism identification. Principally, the biomolecules are allowed to gain or lose electrons (ionization) and then sorted based on their mass to charge ratio, when subjected to electric or magnetic field. The spectrum generated is analyzed and compared to stored profiles using software. These spectra, which are species-specific, can be used to confirm microorganism, for example, E . coli or discriminating closely related species such as E . coli and Shigella.

5. Convergence of E . coli isolates

E . coli form a large diverse species of bacteria that is difficult to handle when targeting a specific strain. Working on any E . coli -suspect colony from less discriminatory procedures prolong the time interval to isolate confirmation and utilizes more resources. The use of selective media helps to achieve this goal, but only when target E . coli strain is well defined. Otherwise, other approaches should be employed. Selection of E . coli isolates with some common features may be used to narrow down the population size. Converging similar E . coli isolates can be done by employing different procedures that utilize antimicrobial resistance, enzymatic, and immunogenic reactions and genetic characteristics of specific E . coli to mention a few. The choice of the method of converging E . coli isolates depends on different factors including study objectives, bacteria characteristics, skill, and resource availability.

Resistance to a single antimicrobial agent or combined resistance to more than one antimicrobial agent can be used to get E . coli isolates with common features. Resistance to common antimicrobial agents used in an area can be used to screen E . coli isolates before further analyses. For example, in a study to assess genetic similarities between E . coli isolates from humans, cattle, and the environment, Lupindu and his colleagues [ 12 ] chose to isolate E . coli with resistance to tetracycline and ampicillin to concentrate E . coli from the general population. E . coli isolated from MacConkey agar was subjected to ampicillin-tetracycline solution using Petrifilm Select E . coli count (SEC) plate. Out of 1046 E . coli isolated from MacConkey agar, 118 isolates were resistant to ampicillin-tetracycline drug combination. Antimicrobial stock solution and bacteria inoculation were executed as previously described in Ref. [ 13 ]. One milliliter of antimicrobial stock solution containing 0.32 mg ampicillin and 0.64 mg was placed on the bottom lid. After 2 h of absorption of the antimicrobial solution, 2 μl of standardized sample suspension was spot-inoculated onto the antimicrobial embedded lower lid of Petrifilm SEC plate. The upper lid was closed after 10 min, and the plate incubated at 42°C for 24 h. Round, medium-sized E . coli colonies appear dark-green due to the presence of β-glucuronidase activity on glucuronide substrate in indicator embedded medium. This procedure was also used to confirm the E . coli isolates that were further analyzed by PFGE for their genetic relatedness.

Ability of some E . coli strains to ferment different sugars can be used to concentrate strains of interest. All E . coli are lactose fermenters, but only some can ferment sorbitol. Sorbitol (instead of lactose) is mixed with MacConkey agar to form sorbitol MacConkey agar. This media can be used to discriminate sorbitol fermenting E . coli from nonsorbitol fermenters (NSF) and hence narrow down the E . coli population to a group of interest. The most common pathogenic E . coli that can be targeted by this procedure is E . coli O157:H7. Majority of E . coli O157:H7 and a few other diarrheagenic E . coli strains do not ferment sorbitol. Many studies to isolate E . coli O157:H7 have used sorbitol MacConkey agar. For example, Lupindu and friends [ 14 ], instead of focusing on every brown-colored, medium-sized round colony grown on MacConkey agar, they went for nonsorbitol fermenters in search for O157:H7. Sorbitol MacConkey agar was supplemented with antimicrobials cefexime and tellurite to inhibit growth of other bacteria such as Aeromonas and Proteus species and thus improving the recognition of nonsorbitol fermenting E . coli . The plates were inoculated with sample suspension and incubated at 37°C for 24 h. Nonsorbitol fermenting bacteria appeared colorless. NSF E . coli were confirmed by biochemical method. In this procedure, where one isolate was selected from each sample, the authors managed to recover 143 NSF E . coli isolates from the total of 1046 samples analyzed. The NSF E . coli isolates were further analyzed by molecular techniques, for example, PCR and DNA hybridization and serology to determine their virulence genes and pathotypes. Of 95 NSF E . coli isolates from cattle, 4 (4.2%) were E . coli O157:H7, carrying vtx2c genes.

Concentration of E . coli isolates can be achieved by molecular techniques where a specific part of the DNA is compared for different isolates. PFGE is one of the commonly used methods to bring together E . coli isolates with similar attribute prior to further analyses. Specific base pair sites of the DNA are cut by special enzymes, amplified, and electrophoresed by applying electric voltage in three directions periodically. It is suitable even for comparison of large DNA fragments up to 20 kb. PFGE can be reliably used as final analyses in the outbreak investigation in Ref. [ 12 ], but sequencing is becoming an adjunct to PFGE whereby isolates with identical PFGE bands are further subtyped by sequencing to give a more detailed discrimination in Ref. [ 15 ]. In outbreak situations, isolates are fingerprinted by PFGE, but detailed discrimination among isolates especially from different outbreak in different locations is obtained by sequencing. For example, Turabelidze and colleagues [ 16 ] sequenced pathogenic E . coli that was congregated by PFGE. It was reported that these isolates had identical PFGE band, but their differences were revealed by sequencing. Likewise, Trees et al. [ 17 ] sequenced 240 isolates related to outbreaks from different sources by PFGE fingerprinting. As a result, whole genome sequencing of 228 isolates showed that they were Shiga toxin-producing E . coli , whereas other 12 isolates were non-Shiga toxin-producing diarrheagenic E . coli .

Moreover, E . coli isolates can be brought together by making use of common antigenic features they possess. Antibodies specific to the bacteria antigen are used to trap the bacteria in enrichment broth. Magnetic beads are coated with specific antibodies for specific bacteria antigen. When beads are applied to the culture broth, antigen will attract antibody resulting in bacteria-bead complex. The complexes are brought together by a magnetic field and concentrate at the bottom of the tube. After decantation, concentrated bacteria-bead complexes are inoculated on a solid media and incubated at 37°C for 24 h. The culture is then analyzed by other methods such as PCR or sequencing. Immunomagnetic separation (IMS) can be used to isolate different bacterial and fungal species. Different strains of Shiga toxin-producing E . coli can be isolated by this procedure. These include all Shiga toxin-producing E . coli with somatic antigen O157, O26, O45, O103, O111, O113, O121, and O145 [ 18 ].

Chromogenic media can also be used to concentrate bacteria possessing some enzymes whose action on sugars brings changes that are detected and depicted by indicating color change. E . coli are distinguished from other coliforms by the presence of β-glucuronidase activity on glucuronide. Examples of chromogenic media for coliform discrimination are Brilliance E . coli agar and Petrifilm Select E . coli count plate. Apart from differentiating the coliforms, these media can be used to sort out between β-glucuronidase positive and negative E . coli since there are a few E . coli strains that are β-glucuronidase negative, for example, E . coli O157:H7 [ 19 ]. Beta-glucuronidase positive isolates will appear purple on Brilliance E . coli agar or dark-green on Petrifilm Select E . coli count plate. The use of chromogenic media is usually followed by analyses by other techniques, for example, PCR, PFGE, or sequencing [ 20 ].

6. Storage of E . coli isolates

Preservation of bacteria aims at slowing the rate of harmful reactions in bacteria cultures so as to maintain viability and genetic attributes for future use. When imminent analyses require intact live cell, the storage method becomes very important. Different methods can be used to store pure E . coli and other bacteria isolates for future analyses [ 21 ]. Removal of water from the bacteria culture (drying) can be one option in preserving bacteria cells, while low temperature storage can also reduce the rate of chemical reaction in the cell culture and hence prolong bacteria viability. Drying of the bacteria cells may involve freeze and vacuum drying. In freeze drying, also called lyophilization or cryodesiccation, bacteria are suspended in a medium which maintain their viability through freezing, water removal, and storage. Principally, the bacteria in 15% glycerol suspension are frozen on dry ice or liquid nitrogen and subjected to high vacuum line that allows bacteria to dry through water sublimation. In vacuum drying, the bacteria are dried over calcium chloride in vacuum. Both freeze and vacuum-dried bacteria cultures are stored at 4°C for long time. Low temperature storage of bacteria involves keeping bacteria at low temperatures, ranging from 4 to −80°C. Freezing usually requires addition of glycerol or sugars as cryoprotectants. Deep freezing is the most common preservation method, which maintains both survival and similarity of bacteria population compared with other methods. The choice of the method of preservation depends on several factors, including the nature of bacteria, desired length of time of storage, analysis strategy, and study objectives.

Short period preservation, for example, for days or a week, bacteria can be stored under refrigeration temperatures. Pure bacteria culture is grown on agar slants or plates of nondifferential media and stored at 4°C. Screw-capped tubes are recommended when agar slants are used in bacteria preservation. Cultures on Petri dishes should be protected from contamination and rapid drying by sealing the plates with parafilm and stored inverted. Screw-capped tubes with hot sterile media are inclined at an angle to allow the media to solidify into a slant. A loopful of pure bacteria culture is inoculated onto the slant surface and incubated at 37°C for 24 h. The slant is then refrigerated for future use of bacteria.

Freezing is another method used to store bacteria whereby, the degree of coldness corresponds to length of storage period. The colder the storage temperature, the longer the culture will retain viable cells. Freezing temperatures of −20 to −40°C, which is achieved by most laboratory freezers, can be used to preserve bacteria for up to 1 year. Low temperature of −80°C can preserve bacteria for longer than 3 years, whereas cryofreezing at temperatures below −130°C, usually in liquid nitrogen, can preserve bacteria for more than 10 years.

Freezing may damage or kill bacteria cells due to resultant physical and chemical processes taking place. During freezing, water in the bacteria cell is converted to ice and solutes accumulate in the residual free water. Ice crystals formed can damage the cell membrane and the negative solute concentration can denature cell biomolecules. Cryoprotectants such as glycerol lower the freezing point of the bacteria suspension and thus prevent extracellular ice crystal formation and build-up of negative salt concentration. Besides, the lethal intracellular freezing is usually avoided by slow cooling or progressive freezing that allows sufficient water to leave the cell during freezing of extracellular fluid. A slow progressive freezing at a cooling rate of 1°C/min can be achieved by using a rate controlled freezer. Alternatively, similar results can be obtained by “snap freezing.” Bacteria cells are snap-frozen by immersing the well-labeled 15% glycerol cell suspension containing cryotubes in dry ice or liquid nitrogen before storing them in freezer (−20 to −80°C) or in liquid nitrogen tank (−196°C) [ 22 ].

Bacteria cultures for freeze preservation can be prepared by inoculating a loopful of bacteria culture into nondifferential sterile broth such as nutrient broth followed by 37°C incubation for 24 h. This broth with pure bacteria culture is mixed with glycerol to make it 15–20% glycerol. Pure glycerol is a thick viscous liquid that needs dilution for practical handling. One-to-one dilution of pure glycerol with sterile normal saline is usually required, for example, 100 ml of glycerol is mixed with 100 ml of normal saline. As a result, for any required amount of pure glycerol, the diluted volume should be doubled. For example, if you want to store bacteria in 20% glycerol broth in a cryovial of 2 ml capacity, you need to put 600 μl of culture broth into a cryovial and add 400 μl of diluted glycerol. This 1 ml culture broth of 20% glycerol can be stored at −20, −80, or −196°C.

All E . coli strains can be revived by inoculation on blood agar, nutrient agar, or any nonselective media. A loopful of culture is inoculated onto the agar and incubated at 37°C for 18–24 h. Do not allow to thaw whenever frozen cultures intended for further storage are in use.

7. Characterization of E . coli isolates

Characterization includes detection of bacteria isolates from different sources and typing of bacteria isolates of same species. E . coli can be characterized by different methods, depending on what attribute is targeted. The methods are categorized as serology, molecular techniques, or cytopathic assays. Molecular characterization includes numerous techniques such as PCR, DNA hybridization, PFGE, restricted fragment length polymorphism (RFLP) and multilocus variable-number tandem repeat analysis (MLVA) to mention a few. These variable methods of bacteria typing have previously been summarized and compared in Ref. [ 19 ]. A combination of different methods can be used to complement each other especially when accurate diagnosis is required in a public health threat. A good example of combination of different characterization methods is the work reported by Sabat et al. [ 23 ], whereby isolates confirmed to possess somatic antigen O157 by agglutination test were further characterized by PCR subtyping of verotoxigenic (vtx) genes, O:H serotyping, Vero cell assay, sorbitol fermentation, β-glucuronidase activity, dot blot hybridization, and PFGE.

7.1. Serotyping

Presence of antigenic components that characterize a specific E . coli strain can be detected by using specific antibodies, for instance, presence of somatic antigen O, capsular antigen K, and flagella antigen H can be detected by agglutination tests and using specific antisera. The somatic and flagella antigens are tested against each specific antiserum, or they are tested against pools of antisera first and then tested against each of the specific antisera from the positive pools. The number of positive antisera is used in O and H antigen nomenclature, for example, E . coli O113:H21, O142:H34, and O157:H7. There are more than 180 O somatic antigens and more than 50 H-flagella antigens that are known and used as reference in E . coli serotyping. [ 24 ]. E . coli antigen serotyping has been described in detail by Ørskov and Ørskov [ 25 ].

7.2. Polymerase chain reaction ( PCR)

Polymerase chain reaction is performed to characterize E . coli strains by targeting different virulence genes coding for different virulence factors. Common virulence factors for IPEC include verocytotoxin1, verocytotoxin 2, intimin, heat-stable enterotoxin, human variant, heat-stable enterotoxin, porcine variant, heat labile enterotoxin, and invasive plasmid antigen ( Table 2 ). These virulence genes can be detected using multiplex DEC PCR kit as previously described in Ref. [ 26 ].

Table 2.

Gene target, primer sequence, and amplicon size for common intestinal pathogenic E . coli virulence factors (Adapted from Persson et al. [ 26 ]).

EXPEC commonly carry virulence factor causing urinary tract or nervous tissue infection characterized by syndromes such as urosepsis, pyelonephritis, prostatitis, cystitis, and meningitis. More than 30 virulence factors carried by EXPEC have been reported in Refs. [ 27 , 28 ]. These include papA , papC , papEF , papG , papG II (±III), papG III (±II), papG II + III, sfa , focDE , sfaS , focG , afa / draBC , iha , bmaE , gafD , fimH , hlyD , cnf1 , cdtB , fyuA , iutA , iroN , ireA , kpsM II, K1 kpsM , K2 kpsM , kpsMT III, rfc , cvaC , traT , iss , ibeA , ompT , H7 fliC , malX , and ibeA . Commercial multiplex PCR kits are available for detection different virulence genes for EXPEC.

Verocytotoxin ( vtx ) genes form the most variable group of IPEC virulence factors that can further be characterized by PCR into vtx1 and vtx2 . Within vtx1 and vtx2 groups further subtyping can be done as previously described in Ref. [ 29 ]. As a result, 10 subtypes have been identified, three for vtx1 ( vtx1a , vtx1c and vtx1d ) and seven for vtx2 ( vtx2a , vtx2b , vtx2c , vtx2d , vtx2e , vtx2f and vtx2g ). This subtyping is important because the subtype differ in virulence and disease syndrome they cause. Moreover, these details are needed when comparison of isolates from different cases/outbreaks is desired.

Detection of virulence factors and genetic relatedness of E . coli isolates can also be assessed by DNA hybridization. This a phenomenon whereby a single strand of DNA anneals to a complementary single-stranded DNA fragment (probe) to form a hybrid. Since the probe is labeled, formation of a hybrid molecule is detected and hence showing presence of its complementary (target) nucleic acid strand. Apart from detection of conventional virulence genes, DNA hybridization can be used as a complementary to PCR to check for additional virulence factors [ 14 , 30 ]. Analyses of additional virulence factors by hybridization can assist in differentiation of closely related isolates. For instance, EPEC pathotypes possess eae gene, and they can be differentiate into classical EPEC and A/EEC through DNA hybridization. Classical EPEC possesses bfp that codes for bundle-forming pili (BFP) [ 14 , 31 ]. Different DNA probes can be used in hybridization such as vtx1 , vtx2 , eae , enterohaemolysin ( ehxA ), EPEC adherence factor ( EAF ), bundle-forming pilus ( bfpA ), saa , astA , and vtx2f . The protocols for DNA hybridization have previously explained in Refs. [ 30 , 32 , 33 ].

7.3. DNA sequencing

This is the determination of precise order of bases in the nucleotides that make a specific segment of a DNA. Apart from characterization of genetic material for the purpose of identification of E . coli strain, DNA sequencing assist in comparison of genetic makeup from different sources, for example, in assessment of the association of different disease outbreak. Generally, sequencing use electrophoresis to separate pieces of DNA into bands. DNA molecules move through the gel when an electric current is applied and molecules are separated according to size, small molecules move faster. During sequencing, bases are tagged with fluorescence dyes, each base type producing a different color, for example, thymine = blue, cytosine = green, adenine = red, and guanine = yellow. Artificial modified bases are added to the DNA mixture. DNA molecules will undergo copying many times. When one of the modified bases is incorporated into the DNA molecule, elongation of the chain stops and all DNA pieces in that batch will have an ending with that particular modified base. The next batch of DNA copy will have a different artificial base at the end and so on. As a result, different DNA batches will end with different base T, A, G, and C, each with a specific color. So the base sequence in the assembled DNA material will be determined by a color pattern of the last (modified) base. The information is stored in computer memory and used for interpretation. This is a traditional Sanger sequencing. Besides, the fast advancing technology is taking the investigative life science from a few DNA fragments analysis into another level of whole genome sequencing. Next Generation Sequencing analyses the entire genome in a short time of single sequencing run. As a result, analysis and comparison of whole genome of isolates lead to correct diagnostic inference. Principally, next generation sequencing is similar to conventional Sanger method, but the former, through sequencing by synthesis, allows detection of single bases as they are incorporated into a growing DNA strand until the whole genome is read. Moreover, millions of reactions take place in parallel and many samples can be analyzed at once.

Sequencing is superior to other methods in characterization of genetic material. For example, whole genome sequencing can detect false positive and false negative clonal relationship of isolates from PFGE fingerprinting [ 34 ]. Regardless of the approach to the genome as a whole, the actual process of DNA sequencing is the same. Guidelines and protocols for sequencing are described in detail by a number of researchers in Refs. [ 35 , 36 ], such that it is possible for many laboratories to manage the procedure.

7.4. Phenotypic characterization of E . coli

The genetic expression of E . coli , especially pathogenic E . coli , can be evaluated by applying the toxin extract from the bacteria to the monolayer Vero cell culture. Cytopathic effects to the cells will indicate virulence activities of the genes. Details of cytotoxic effect assay on Vero cell have been documented in Ref. [ 37 ]. Mouse inoculation can also be done to assess virulence of genes.

8. Common E . coli pathotypes

Intestinal pathogenic E . coli form a large proportion of pathogenic E . coli . They include VTEC, EPEC, ETEC, EAEC, DAEC, and EIEC.

Verocytotoxigenic E . coli ( VTEC ) produces verocytotoxins also known as Shiga toxins. The most common VTEC is O157:H7 strain. VTEC are characterized by possession of genes encoding for vtx1 and vtx2 , although they carry other virulence genes such as eae and ehxA . Animals are principal reservoirs of VTEC, and the main route of transmission is fecal-oral. In humans, especially children and elderly, VTEC cause abdominal cramps associated with diarrhea or dysentery. Complicated cases of VTEC infection may lead to HUS. VTEC can be isolated from different sources by different approaches, but the choice will depend on the objectives. Reliance on sugar fermentation ability, for example, sorbitol or presence of specific enzymes, for example, beta-glucuronidase, may lead to focus on specific fraction of the pathogen. On the other hand, targeting verocytotoxin-producing genes will give the overall burden of VTEC from a target source. In this scenario, the use of IMS technique may be recommended [ 28 ]. Characterization of isolates for VTEC detection may include immunological methods by using specific antibodies against target VTEC strain or PCR by targeting specific genes. VTEC isolates typing can be done by serology, using specific antisera, PFGE, DNA hybridization, and sequencing.

Enteropathogenic E . coli ( EPEC ) possess eae just as do some VTEC strains. As a result they cause attaching and effacing lesion and hence diarrhea. Classical EPEC differs from atypical EPEC (A/EEC) by possession of bfpA gene. However, atypical EPEC is a more prevalent cause of diarrhea [ 38 ]. Human EPEC infection follows fecal-oral route and isolation can be done from different sources such as water, food, animal, and environment. However, characterization emphasize should be put on distinguishing EPEC from VTEC by presence of eae gene and absence of vtx genes. Also, classical EPEC and atypical EPEC should be differentiated by assessing the presence of bfpA gene that encode for bundle-forming pili. These features can be determined by characterization procedures such as PCR and DNA hybridization [ 14 ]. PFGE typing can be applied to compare strains during outbreaks.

Enterotoxigenic E . coli ( ETEC ) are responsible for watery diarrhea in humans due to impaired sodium absorption and enhanced chloride secretion caused by enterotoxins. Fecal-oral contamination is responsible for transmission through food and water, and the syndrome is common to travellers and children. A simple procedure for detection of ETEC from stool has been described earlier in Ref. [ 38 ]. Heat-stable and heat-labile enterotoxins encoded by heat-stable enterotoxin ( estA ) and heat-labile enterotoxin ( eltA ) genes, respectively, are responsible. These genes can be easily detected by serological assays [ 39 ] and multiplex DEC PCR.

Enteroaggregative E . coli ( EAEC ) causes acute and persistent diarrhea in humans. This group has diverse strains differing in many aspects but have a common feature of forming a “stacked brick” pattern of adhesion to the human epithelial cell line HEp-2. This feature is used in HeLa cell adherence method to detect EAEC strains [ 40 ]. They often produce heat-stable toxin EAST1, Shigella enterotoxin (ShET1), and Haemolysin E, which cause host cell damage and induce inflammation leading to diarrhea especially in travellers, children, and immunocompromised patients. The EAEC strains are found in mixed infections whereby isolation by MacConkey ager, detection by conventional biochemical methods, and PCR and typing by PFGE are possible [ 41 ].

Diffusely adherent E . coli ( DAEC ) are responsible for acute diarrhea in humans. DAEC are characterized by the ability to adhere to Hep-2 cells in a diffuse fashion as confirmed by HeLa cells assays. Isolation is done conventionally and detection by PCR can be done by targeting Afa/Dr genes [ 42 ].

Enteroinvasive E . coli ( EIEC ) cause profuse diarrhea or dysentery in human through mechanical damage of host epithelial cell by using adhesin protein for binding and invading/entering intestinal cells. They do not produce toxin. EIEC resembles Shigella species biochemically and genetically. Most of them do not ferment lactose. Following conventional isolation methods, EIEC are detected by invasion plasmid antigens ( ipaH ) gene-targeted PCR [ 43 ]. The invasiveness of EIEC can be assessed by plaque formation on HeLa cell or guinea pig conjunctivitis assays.

Extra - intestinal pathogenic E . coli ( EXPEC ) cause a wide range of bacteraemia-associated disease syndromes. EXPEC have been isolated in patients with cystitis, pyelonephritis, or prostatitis [ 28 ]. Other syndromes associated with EXPEC include septic arthritis or pyomyositis, nontraumatic meningitis, or hematogenous osteomyelitis and pneumonia [ 44 ]. This group is comprised of UPEC, NMEC, and SEPEC [ 1 ]. Infection normally follows fecal-oral route. Samples to collect will depend on infected system; urine samples can be collected for urinary tract infection-related syndromes, such as cystitis, Pyelonephritis, or Prostatitis [ 28 ], whereas blood, joint fluid, psoas fluid, or sputum are target samples when nonurinary syndromes are concerned [ 44 ]. Isolation of E . coli for EXPEC detection can follow methods that have been mentioned previously for other pathotypes. Detection of EXPEC can be done by multiplex PCR targeting different genes some of which have been previously described and dot blot hybridization [ 1 , 20 , 27 , 28 ]. Typing of isolates from different sources can be done by different procedures including PFGE [ 20 ].

9. The viable but nonculturable (VBNC) state

E . coli viability has been reported to decrease when the cells are exposed to direct sunlight because they enter a viable but nonculturable (VBNC) state, while retaining pathogenic ability [ 45 ]. Some factors that are directly or indirectly linked to sample collection, storage, or processing may contribute toward E . coli entering VBNC state. These include nutrient starvation, elevated or lowered osmotic concentration, oxygen concentration, exposure to heavy metals or food preservatives, direct sunlight, and incubation outside normal temperature range [ 46 ]. These factors may lead to false-negative outcomes because E . coli does not grow on standard laboratory media when they are under VBNC state. When some of VBNC inducing factors are difficult to avoid, then E . coli detection methods that do not rely on viable or live cells, for example, DNA-dependent methods such as PCR, can be a perfect option.

10. Conclusion

Dealing with a diverse group of bacteria like E . coli may present a challenge. Knowledge on basics of E . coli in terms of isolation and characterization may help in planning, setting objectives, and execution of E . coli -related research. One should bear in mind that choice of one isolation or characterization approach may lead to a different output compared to another approach.

The current procedures for E . coli isolation and characterization take at least 72 h and sometimes even more time. The need to work on viable bacteria cells may be contributing much to this lengthy procedure. Working on the genetic material right from the sample could help to shorten the time spent from isolation of E . coli from sample to outcome. This should be the direction of future research.

• 1. Köhler CD, Dobrindt U. What defines extraintestinal pathogenic Escherichia coli ? International Journal of Medical Microbiology. 2011; 301 :642-647. DOI: 10.1016/j.ijmm.2011.09.006
• 2. Kirk MD, Pires SM, Black RE, Caipo M, Crump JA, Devleesschauwer, B, et al. World Health Organization estimates of the global and regional disease burden of 22 food-borne bacterial, protozoal, and viral diseases, 2010: a data synthesis. PLoS Medicine. 2015; 12 (12):e1001921. DOI: 10.1371/journal.pmed.1001921
• 3. US Geological Survey. USGS Water-Quality Information [Internet]. 2007 [Updated: May, 2014]. Available from: http://water.usgs.gov/owq/FieldManual/Chapter7/index.html [Accessed: 7 August, 2016]
• 4. Arthur TM, Nou X, Kalchayanand N, Bosilevac JM, Wheeler T, Koohmaraie M. Survival of Escherichia coli O157:H7 on cattle hides. Applied and Environmental Microbiology. 2011; 77 (9):3002-3008. DOI: 10.1128/AEM.02238-10
• 5. Pope M, Bussen M, Feige M, Shadix L, Gonder S, Rodgers C, et al. Assessment of the effects of holding time and temperature on Escherichia coli densities in surface water samples. Applied Environmental Microbiology. 2003; 69 (10):6201-6207. DOI: 10.1128/AEM.69.10.6201-6207.2003
• 6. Achá SJ, Kühn I, Mbazima G, Colque-Navarro P, Möllby R. Changes of viability and composition of the Escherichia coli flora in faecal samples during long time storage. Journal of Microbiological Methods. 2005; 63 :229-238. DOI: 10.1016/j.mimet.2005.04.024
• 7. Masters N, Christie M, Stratton H, Katouli M. Viability and stability of E . coli and enterococci populations in fecal samples upon freezing. Canadian Journal of Microbiology. 2015; 61 (7):495-501. DOI: 10.1139/cjm-2015-0020
• 8. Irwin PL, Nguyen LHT, Paoli GC, Chen CY. Evidence for a bimodal distribution of Escherichia coli doubling times below a threshold initial cell concentration. BMC Microbiology. 2010; 10 (1):207. DOI: 10.1186/1471-2180-10-207
• 9. Sargeant JM, Gillespie JR, Oberst RD, Phebus RK, Hyatt DR, Bohra LK, et al. Results of a longitudinal study of the prevalence of Escherichia coli O157: H7 on cow-calf farms. American Journal of Veterinary Research. 2000; 61 (11):1375-1379. DOI: 10.2460/ajvr.2000.61.1375
• 10. Heuvelink AE, Van Den Biggelaar FLAM, De Boer E, Herbes RG, Melchers WJG, Huis JHJ, et al. Isolation and characterization of verocytotoxin-producing Escherichia coli O157 strains from Dutch cattle and sheep. Journal of Clinical Microbiology. 1998; 36 (4):878-882.
• 11. Powers EM, Latt TG. Simplified 48-hour IMVic test: an agar plate method. Applied and Environmental Microbiology. 1977; 34 (3):274-279.
• 12. Lupindu AM, Dalsgaard A, Msoffe PLM, Ngowi HA, Mtambo MM, Olsen JE. Transmission of antibiotic-resistant Escherichia coli between cattle, humans and the environment in peri-urban livestock keeping communities in Morogoro, Tanzania. Preventive Veterinary Medicine. 2015; 118 (4):477-482. DOI: 10.1016/j.prevetmed.2014.12.005
• 13. Wu S, Chouliara E, Jensen LB, Dalsgaard A. Evaluation of petrifilm™ select E . coli count plate medium to discriminate antimicrobial resistant Escherichia coli . Acta Veterinaria Scandinavica. 2008; 50 (1):38. DOI: 10.1186/1751-0147-50-38
• 14. Lupindu AM, Olsen JE, Ngowi HA, Msoffe PLM, Mtambo MM, Scheutz F, et al. Occurrence and characterization of shiga toxin-producing Escherichia coli O157:H7 and other non-sorbitol-fermenting E . coli in cattle and humans in urban areas of Morogoro, Tanzania. Vector-Borne and Zoonotic Diseases. 2014; 14 (7):503-510. DOI: 10.1089/vbz.2013.1502
• 15. Miller JM. Whole-genome mapping: a new paradigm in strain-typing technology. Journal of Clinical Microbiology. 2013; 51 (4):1066-1070. DOI: 10.1128/JCM.00093-13
• 16. Turabelidze G, Lawrence SJ, Gao H, Sodergren E, Weinstock GM, Abubucker S, et al. Precise dissection of an Escherichia coli O157:H7 outbreak by single nucleotide polymorphism analysis. Journal of Clinical Microbiology. 2013; 51 (12):3950-3954. DOI: 10.1128/JCM.01930-13
• 17. Trees E, Strockbine N, Changayil S, Ranganathan S, Zhao K, Weil R, et al. Genome sequences of 228 shiga toxin-producing Escherichia coli isolates and 12 isolates representing other diarrheagenic E . coli pathotypes. Genome Announcements. 2014; 2 (4):e00718–e00714. DOI: 10.1128/genomeA.00718-14
• 18. DebRoy C, Roberts E, Valadez AM, Dudley EG, Cutter CN. Detection of shiga toxin-producing Escherichia coli O26, O45, O103, O111, O113, O121, O145, and O157 serogroups by multiplex polymerase chain reaction of the wzx gene of the O-antigen gene cluster. Foodborne Pathogens and Disease. 2011; 8 (5):651-652. DOI: 10.1089/fpd.2010.0769
• 19. Soborg B, Lassen SG, Muller L, Jensen T, Ethelberg S, Molbak K, et al. A verocytotoxin producing E. coli outbreak with a surprisingly high risk of haemolytic uraemic syndrome, Denmark, September–October 2012. Euro Surveillance. 2013; 18 (2):20350
• 20. Mohamed M, Owens K, Gajewski A, Clabots C, Johnston B, Thuras P, et al. Extraintestinal Pathogenic and Antimicrobial-Resistant Escherichia coli Contamination of 56 Public Restrooms in the Greater Minneapolis-St. Paul Metropolitan Area. Applied and Environmental Microbiology. 2015; 81 (13):4498-4506. DOI: 10.1128/AEM.00638-15
• 21. Jahn M, Seifert J, Hübschmann T, von Bergen M, Harms H, Müller S. Comparison of preservation methods for bacterial cells in cytomics and proteomics. Journal of Integrated Omics. 2013; 3 (1):25-33. DOI: 10.5584/jiomics.v3i1.115
• 22. Bonavia A, Thompson M, Schryver B, Ehrhardt R. Bacteria cryopreservation protocol. Protocol Exchange. 2012. DOI: 10.1038/protex.2012.006
• 23. Sabat AJ, Budimir A, Nashev D, Sá-Leão R, van Dijl JM, Laurent F, et al. Overview of molecular typing methods for outbreak detection and epidemiological surveillance. Euro Surveillance. 2013; 18 (4):pii: 20380.
• 24. O’Sullivan J, Bolton DJ, Duffy G, Baylis C, Tozzoli R, Wasteson Y, et al., editors. Methods for Detection and Molecular Characterisation of Pathogenic Escherichia coli . Dublin: Pathogenic Escherichia coli Network (PEN); 2007. 34 p.
• 25. Ørskov F, Ørskov I. Serotyping of Escherichia coli . In: Bergan T., editor. Methods in Microbiology. 1st ed. London: Academic Press; 1984. p. 43-112. DOI: 10.1016/S0580-9517(08)70447-1
• 26. Persson S, Olsen KEP, Scheutz A, Krogfelt KA, Gerner-Smidt P. A method for fast and simple detection of major diarrhoeagenic Escherichia coli in the routine diagnostic laboratory. Clinical Microbiology and Infection. 2007; 13 :516-524. DOI: 10.1111/j.1469-0691.2007.01692.x
• 27. Johnson JR, Stell AL. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. Journal of Infectious Diseases. 2000; 181 (1):261-272. DOI: 10.1086/315217
• 28. Johnson JR, Kuskowski MA, Gajewski A, Soto S, Horcajada JP, de Anta MTJ, et al. Extended virulence genotypes and phylogenetic background of Escherichia coli isolates from patients with cystitis, pyelonephritis, or prostatitis. Journal of Infectious Diseases. 2005; 191 (1):46-50. DOI: 10.1086/426450
• 29. Scheutz F, Teel LD, Beutin L, Piérard D, Buvens G, Karch H, et al. Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. Journal of Clinical Microbiology. 2012; 50 (9):2951-2963. DOI: 10.1128/JCM.00860-12
• 30. Gerrish RS, Lee JE, Reed J, Williams J, Farrell LD, Spiegel KM, et al. PCR versus hybridization for detecting virulence genes of enterohemorrhagic Escherichia coli . Emerging Infectious Diseases. 2007; 13 (8):1253-1255. DOI: 10.3201/eid1308.060428
• 31. Jensen C, Ethelberg S, Olesen B, Schiellerup P, Olsen KEP, Scheutz F, et al. Attaching and effacing Escherichia coli isolates from Danish children: clinical significance and microbiological characteristics. Clinical Microbiology and Infection. 2007; 13 (9):863-872. DOI: 10.1111/j.1469-0691.2007.01773.x
• 32. Scaletsky ICA, Fabbricotti SH, Aranda KR, Morais MB, Fagundes-Neto U. Comparison of DNA hybridization and PCR assays for detection of putative pathogenic enteroadherent Escherichia coli . Journal of Clinical Microbiology. 2002; 40 (4):1254-1258. DOI: 10.1128/JCM.40.4.1254-1258.2002
• 33. Anjum MF, Lucchini S, Thompson A, Hinton JC, Woodward MJ. Comparative genomic indexing reveals the phylogenomics of Escherichia coli pathogens. Infection and Immunity. 2003; 71 (8):4674-4683. DOI: 10.1128/IAI.71.8.4674-4683.2003
• 34. Salipante SJ, SenGupta DJ, Cummings LA, Land TA, Hoogestraat Dr, Cookson BT. Application of whole-genome sequencing for bacterial strain typing in molecular epidemiology. Journal of Clinical Microbiology. 2015; 53 (4):1072-1079. DOI: 10.1128/JCM.03385-14
• 35. Metzker ML. Sequencing technologies—the next generation. Nature Reviews Genetics. 2010; 11 (1):31-46. DOI: 10.1038/nrg2626
• 36. Kwong JC, McCallum N, Sintchenko V, Howden BP. Whole genome sequencing in clinical and public health microbiology. Pathology—Journal of the RCPA . 2015; 47 (3):199-210. DOI: 10.1097/PAT.0000000000000235
• 37. El-Housseiny GS, Aboulwafa MM, Hassouna NA. Cytotoxic activities of some Escherichia coli isolates: possible mechanisms and approaches for inhibition. Journal of American Science. 2010; 6 (10):269-283.
• 38. Ochoa TJ, Contreras CA. Enteropathogenic E . coli (EPEC) infection in children. Current Opinion in Infectious Diseases. 2011; 24 (5):478-483. DOI: 10.1097/QCO.0b013e32834a8b8b
• 39. Işeri L, Apan TZ, Aksoy A, Koç F, Göçmen JS, Nuristani D. The prevalence of enterotoxigenic E . coli isolated from the stools of children aged 0-10 years with diarrhea in mid-Anatolia region, Turkey. Brazilian Journal of Microbiology. 2011; 42 (1):243-247. DOI: 10.1590/S1517-83822011000100030
• 40. Aslani MM, Alikhani MY, Zavari A, Yousefi R, Zamani AR. Characterization of enteroaggregative Escherichia coli (EAEC) clinical isolates and their antibiotic resistance pattern. International Journal of Infectious Diseases. 2011; 15 (2):e136-e139. DOI: 10.1016/j.ijid.2010.10.002
• 41. Sarantuya J, Nishi J, Wakimoto N, Erdene S, Nataro JP, Sheikh J, et al. Typical enteroaggregative Escherichia coli is the most prevalent pathotype among E . coli strains causing diarrhea in Mongolian children. Journal of Clinical Microbiology. 2004; 42 (1):133-139. DOI: 10.1128/JCM.42.1.133-139.2004
• 42. Mansan-Almeida R, Pereira AL, Giugliano LG. Diffusely adherent Escherichia coli strains isolated from children and adults constitute two different populations. BMC Microbiology. 2013; 13 (22):1. DOI: 10.1186/1471-2180-13-22
• 43. van den Beld M, Reubsaet FAG. Differentiation between Shigella, enteroinvasive Escherichia coli (EIEC) and noninvasive Escherichia coli . European Journal of Clinical Microbiology and Infectious Diseases. 2012; 31 (6):899-904. DOI: 10.1007/s10096-011-1395-7
• 44. Johnson JR, Gajewski A, Lesse AJ, Russo TA. Extraintestinal pathogenic Escherichia coli as a cause of invasive nonurinary infections. Journal of Clinical Microbiology. 2003; 41 (12):5798-5802. DOI: 10.1128/JCM.41.12.5798-5802.2003
• 45. Pommepuy M, Butin M, Derrien A, Gourmelon M, Colwell, RR, Cormier M. Retention of enteropathogenicity by viable but nonculturable Escherichia coli exposed to seawater and sunlight. Applied and Environmental Microbiology. 1996; 62 (12):4621-4626.
• 46. Oliver JD. Recent findings on the viable but nonculturable state in pathogenic bacteria. FEMS Microbiology Reviews. 2010; 34 (4):415-425. DOI: 10.1111/j.1574-6976.2009.00200.x

© 2017 The Author(s). Licensee IntechOpen. This chapter is distributed under the terms of the Creative Commons Attribution 3.0 License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Continue reading from the same book

Escherichia coli.

Published: 12 July 2017

By Tsuyoshi Imai and Thanh-Loc Thi Dang

1814 downloads

By Noel Pabalan, Eloisa Singian, Lani Tabangay and Ha...

1581 downloads

By Vargas-Maya Naurú Idalia and Franco Bernardo

6543 downloads

IntechOpen Author/Editor? To get your discount, log in .

Discounts available on purchase of multiple copies. View rates

Local taxes (VAT) are calculated in later steps, if applicable.

Support: [email protected]

Characterisation of epigenomic variation in natural isolates of E. coli : a thesis submitted in partial fulfilment of the requirements for the degree of Ph.D in Genetics, Massey University, College of Science, School of Natural Sciences, Auckland

Original bundle

Collections

UC San Diego

Model-driven metabolic engineering of Escherichia coli : a systems biology approach

• Feist, Adam Michael

Metabolic engineering of microorganisms will be necessary to advance mankind over the coming centuries. Systems biology has the potential to significantly aide in this effort through design, interpretation, and expansion of experimental implementation. This dissertation outlines work towards advancing the field of systems biology, in general, and specifically focuses on applying this technology to metabolically engineer the bacterium Escherichia coli. The first part of this thesis dissertation focuses on the impact of systems biology in science and engineering through an introduction of the topic and demonstration of systems biology case studies centered on the reconstruction of E. coli metabolism. The history of reconstruction of E. coli metabolism prior to and since the genomic era is presented and provides the scope of the fundamental biological platform, the metabolic reconstruction, for which later computations are based. The process and product of network reconstruction and the developed methods necessary for validation and use are outlined. The second part of the thesis dissertation describes the generation, properties, and biological characterization of two organism-specific genome-scale metabolic reconstructions. These reconstructions are for an environmentally important archaea, Methanosarcina barkeri, and the aforementioned bacteria and model organism, E. coli. The transformation of these reconstructions to computational models is presented along with validation of modeling results through comparison with experimental data. Demonstrations of the utility of metabolic reconstructions as platforms for systems analyses to answer biological questions are presented in application specific examples. The third part of this thesis dissertation describes how the generated metabolic reconstruction of E. coli was used for model-driven metabolic engineering. A computation evaluation of the production potential for native products of E. coli from different feedstocks is presented. This study characterizes the range and number of products that can be coupled to growth in E. coli. Lastly, the in vivo construction, evolution, and characterization of strains computationally designed from this analysis are presented for validation of approach. The generated strains possess production capabilities suitable for further development at a larger scale. Taken in whole, this thesis dissertation describes the process developed, outcomes, and future potential of performing systems metabolic engineering of microorganisms.

Enter the password to open this PDF file:

Information

• Author Services

Initiatives

You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.

All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .

Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.

Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.

Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.

Original Submission Date Received: .

• Active Journals
• Find a Journal
• Proceedings Series
• For Authors
• For Reviewers
• For Editors
• For Librarians
• For Publishers
• For Societies
• For Conference Organizers
• Open Access Policy
• Institutional Open Access Program
• Special Issues Guidelines
• Editorial Process
• Research and Publication Ethics
• Article Processing Charges
• Testimonials
• Preprints.org
• SciProfiles
• Encyclopedia

Article Menu

• Subscribe SciFeed
• Recommended Articles
• Google Scholar
• on Google Scholar
• Table of Contents

Find support for a specific problem in the support section of our website.

Please let us know what you think of our products and services.

Visit our dedicated information section to learn more about MDPI.

JSmol Viewer

Response of escherichia coli to acid stress: mechanisms and applications—a narrative review.

1. Introduction

3. mechanism of different acid-resistance systems in e. coli, 4. cell membrane protection, 5. macromolecular repair, 6. potential application and development of acid-resistant e. coli in industry, 7. conclusions, author contributions, conflicts of interest.

• Bao, Z.; Gao, Y.; Song, Y.; Ding, N.; Li, W.; Wu, Q.; Zhang, X.; Zheng, Y.; Li, J.; Hu, X. Construction of an Escherichia coli chassis for efficient biosynthesis of human-like N-linked glycoproteins. Front. Bioeng. Biotechnol. 2024 , 12 , 1370685. [ Google Scholar ] [ CrossRef ]
• Zhang, Z.; Chu, R.; Wei, W.; Song, W.; Ye, C.; Chen, X.; Wu, J.; Liu, L.; Gao, C. Systems engineering of Escherichia coli for high-level glutarate production from glucose. Nat. Commun. 2024 , 15 , 1032. [ Google Scholar ] [ CrossRef ]
• Luqman, A.; Hassan, A.; Ullah, M.; Naseem, S.; Ullah, M.; Zhang, L.; Din, A.U.; Ullah, K.; Ahmad, W.; Wang, G. Role of the intestinal microbiome and its therapeutic intervention in cardiovascular disorder. Front. Immunol. 2024 , 15 , 1321395. [ Google Scholar ] [ CrossRef ]
• Ma, G.; Shi, Y.; Meng, L.; Fan, H.; Tang, X.; Luo, H.; Wang, D.; Zhou, J.; Xiao, X. Factors affecting the early establishment of neonatal intestinal flora and its intervention measures. Front. Cell. Infect. Microbiol. 2023 , 13 , 1295111. [ Google Scholar ] [ CrossRef ]
• Mitra, S.D.; Shome, R.; Bandopadhyay, S.; Geddam, S.; Kumar, A.P.; Murugesan, D.; Shome, A.; Shome, B.R. Genetic insights of antibiotic resistance, pathogenicity (virulence) and phylogenetic relationship of Escherichia coli strains isolated from livestock, poultry and their handlers-a one health snapshot. Mol. Biol. Rep. 2024 , 51 , 404. [ Google Scholar ] [ CrossRef ]
• Yim, J.; Seo, K.; Chon, J.; Jeong, D.; Song, K. Status and prospects of PCR detection methods for diagnosing pathogenic Escherichia coli : A review. J. Dairy Sci. Biotechnol. 2021 , 39 , 51–62. [ Google Scholar ] [ CrossRef ]
• Park, N.; Hur, J.I.; Lee, S.; Ryu, S. Prevalence of CTX-M types among ESBL-producing pathogenic Escherichia coli isolates from foodborne diarrheal patients in Gyeonggi-do, South Korea. Food Sci. Biotechnol. 2024 , 33 , 2825–2833. [ Google Scholar ] [ CrossRef ]
• Qiu, L.; Chirman, D.; Clark, J.R.; Xing, Y.; Hernandez Santos, H.; Vaughan, E.E.; Maresso, A.W. Vaccines against extraintestinal pathogenic Escherichia coli (ExPEC): Progress and challenges. Gut Microbes 2024 , 16 , 2359691. [ Google Scholar ] [ CrossRef ]
• Guan, N.; Liu, L. Microbial response to acid stress: Mechanisms and applications. Appl. Microbiol. Biotechnol. 2020 , 104 , 51–65. [ Google Scholar ] [ CrossRef ]
• Hao, X.; Chen, B.; An, T. Pathway modification of industrial microorganisms to improve acid-stress tolerance. Sheng Wu Gong Cheng Xue Bao 2015 , 31 , 1151–1161. [ Google Scholar ]
• Li, Z.; Jiang, B.; Zhang, X.; Yang, Y.; Zhu, G. The role of bacterial cell envelope structures in acid stress resistance in E. coli . Appl. Microbiol. Biotechnol. 2020 , 104 , 2911–2921. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• De Biase, D.; Lund, P.A. The Escherichia coli acid stress response and its significance for pathogenesis. Adv. Appl. Microbiol. 2015 , 92 , 49–88. [ Google Scholar ] [ PubMed ]
• Evans, D.F.; Pye, G.; Bramley, R.; Clark, A.G.; Dyson, T.J.; Hardcastle, J.D. Measurement of gastrointestinal pH profiles in normal ambulant human subjects. Gut 1988 , 29 , 1035–1041. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Ibekwe, V.C.; Fadda, H.M.; Mcconnell, E.L.; Khela, M.K.; Evans, D.F.; Basit, A.W. Interplay between intestinal pH, transit time and feed status on the in vivo performance of pH responsive ileo-colonic release systems. Pharm. Res. 2008 , 25 , 1828–1835. [ Google Scholar ] [ CrossRef ]
• Slonczewski, J.L.; Rosen, B.P.; Alger, J.R.; Macnab, R.M. pH homeostasis in Escherichia coli : Measurement by 31 P nuclear magnetic resonance of methylphosphonate and phosphate. Proc. Natl. Acad. Sci. USA 1981 , 78 , 6271–6275. [ Google Scholar ] [ CrossRef ]
• Wilks, J.C.; Slonczewski, J.L. pH of the cytoplasm and periplasm of Escherichia coli : Rapid measurement by green fluorescent protein fluorimetry. J. Bacteriol. 2007 , 189 , 5601–5607. [ Google Scholar ] [ CrossRef ]
• Zilberstein, D.; Agmon, V.; Schuldiner, S.; Padan, E. Escherichia coli intracellular pH, membrane potential, and cell growth. J. Bacteriol. 1984 , 158 , 246–252. [ Google Scholar ] [ CrossRef ]
• Yang, J.; Zhang, J.; Zhu, Z.; Du, G. The challenges and prospects of Escherichia coli as an organic acid production host under acid stress. Appl. Microbiol. Biotechnol. 2021 , 105 , 8091–8107. [ Google Scholar ] [ CrossRef ]
• Lins, M.; Puppin Zandonadi, R.; Raposo, A.; Ginani, V.C. Food waste on foodservice: An overview through the perspective of sustainable dimensions. Foods 2021 , 10 , 1175. [ Google Scholar ] [ CrossRef ]
• Foster, J.W. Acid stress responses of Salmonella and E. coli : Survival mechanisms, regulation, and implications for pathogenesis. J. Microbiol. 2001 , 39 , 89–94. [ Google Scholar ]
• Peter, L.; Angela, T.; Daniela, D.B. Coping with low pH: Molecular strategies in neutralophilic bacteria. FEMS Microbiol. Rev. 2015 , 38 , 1091–1125. [ Google Scholar ]
• Huang, D.H.; Wang, K.; Chiu, C.P.; Pan, T.M.; Tsai, T.Y. Effects of chemical and low-temperature treatments and adaption on the responses of virulence factor genes and outer membrane proteins in Escherichia coli O157:H7. J. Microbiol. Immunol. 2015 , 48 , 604–612. [ Google Scholar ] [ CrossRef ]
• Lin, J.; Lee, I.S.; Frey, J.; Slonczewski, J.L.; Foster, J.W. Comparative analysis of extreme acid survival in Salmonella typhimurium , Shigella flexneri , and Escherichia coli . J. Bacteriol. 1995 , 177 , 4097–4104. [ Google Scholar ] [ CrossRef ]
• Li, G.; Morigen; Yao, Y. TorR/TorS Two-Component system resists extreme acid environment by regulating the key response factor RpoS in Escherichia coli . Gene 2022 , 821 , 146295. [ Google Scholar ] [ CrossRef ]
• Dong, T.; Kirchhof, M.G.; Schellhorn, H.E. RpoS regulation of gene expression during exponential growth of Escherichia coli K12. Mol. Genet. Genom. 2008 , 279 , 267–277. [ Google Scholar ] [ CrossRef ]
• Gama-Castro, S.; Salgado, H.; Peralta-Gil, M.; Santos-Zavaleta, A.; Muniz-Rascado, L.; Solano-Lira, H.; Jimenez-Jacinto, V.; Weiss, V.; Garcia-Sotelo, J.S.; Lopez-Fuentes, A.; et al. RegulonDB version 7.0: Transcriptional regulation of Escherichia coli K-12 integrated within genetic sensory response units (Gensor Units). Nucleic Acids. Res. 2010 , 39 , D98–D105. [ Google Scholar ] [ CrossRef ]
• Geng, H.; Jiang, R. CAMP receptor protein (CRP)-mediated resistance/tolerance in bacteria: Mechanism and utilization in biotechnology. Appl. Microbiol. Biot. 2015 , 99 , 4533–4543. [ Google Scholar ] [ CrossRef ]
• Chakraborti, S.; Dhalla, N.S. Regulation of Ca 2+ -ATPases, V-ATPases and F-ATPases , 1st ed.; Springer International Publishing: Cham, Switzerland, 2016; pp. 459–469. [ Google Scholar ]
• Richard, H.; Foster, J.W. Escherichia coli glutamate- and arginine-dependent acid resistance systems increase internal pH and reverse transmembrane potential. J. Bacteriol. 2004 , 186 , 6032–6041. [ Google Scholar ] [ CrossRef ]
• Biase, D.D.; Pennacchietti, E. Glutamate decarboxylase-dependent acid resistance in orally acquired bacteria: Function, distribution and biomedical implications of the gadBC operon. Mol. Microbiol. 2012 , 86 , 770–786. [ Google Scholar ] [ CrossRef ]
• Castanie-Cornet, M.; Penfound, T.A.; Smith, D.; Elliott, J.F.; Foster, J.W. Control of acid resistance in Escherichia coli . J. Bacteriol. 1999 , 181 , 3525–3535. [ Google Scholar ] [ CrossRef ]
• Patten, C.L.; Kirchhof, M.G.; Schertzberg, M.R.; Morton, R.A.; Schellhorn, H.E. Microarray analysis of RpoS-mediated gene expression in Escherichia coli K-12. Mol. Genet. Genom. 2004 , 272 , 580–591. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Thompson, K.M.; Gottesman, S. The MiaA tRNA modification enzyme is necessary for robust RpoS expression in Escherichia coli . J. Bacteriol. 2014 , 196 , 754–761. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Weber, H.; Polen, T.; Heuveling, J.; Wendisch, V.F.; Hengge, R. Genome-wide analysis of the general stress response network in Escherichia coli : σ S -dependent genes, promoters, and sigma factor selectivity. J. Bacteriol. 2005 , 187 , 1591–1603. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kowalczyk, L.; Ratera, M.; Paladino, A.; Bartoccioni, P.; Errasti-Murugarren, E.; Valencia, E.; Portella, G.; Bial, S.; Zorzano, A.; Fita, I.; et al. Molecular basis of substrate-induced permeation by an amino acid antiporter. Proc. Natl. Acad. Sci. USA 2011 , 108 , 3935–3940. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Lu, P.; Ma, D.; Chen, Y.; Guo, Y.; Chen, G.Q.; Deng, H.; Shi, Y. L-glutamine provides acid resistance for Escherichia coli through enzymatic release of ammonia. Cell Res. 2013 , 23 , 635–644. [ Google Scholar ] [ CrossRef ]
• Ma, Z.; Gong, S.; Richard, H.; Tucker, D.L.; Conway, T.; Foster, J.W. GadE (YhiE) activates glutamate decarboxylase-dependent acid resistance in Escherichia coli K-12. Mol. Microbiol. 2010 , 49 , 1309–1320. [ Google Scholar ] [ CrossRef ]
• Castaniecornet, M.P.; Foster, J.W. Escherichia coli acid resistance: cAMP receptor protein and a 20 bp cis-acting sequence control pH and stationary phase expression of the gadA and gadBC glutamate decarboxylase genes. Microbiology 2001 , 147 , 709–715. [ Google Scholar ] [ CrossRef ]
• Fontenot, E.M.; Ezelle, K.E.; Gabreski, L.N.; Giglio, E.R.; Mcafee, J.M.; Mills, A.C.; Qureshi, M.N.; Salmon, K.M.; Toyota, C.G. YfdW and YfdU are required for oxalate-induced acid tolerance in Escherichia coli K-12. J. Bacteriol. 2013 , 195 , 1446–1455. [ Google Scholar ] [ CrossRef ]
• Krin, E.; Danchin, A.; Soutourina, O. Decrypting the H-NS-dependent regulatory cascade of acid stress resistance in Escherichia coli . BMC Microbiol. 2010 , 10 , 273. [ Google Scholar ] [ CrossRef ]
• Ma, X.; Zhang, S.; Xu, Z.; Li, H.; Lu, Y. SdiA Improves the Acid Tolerance of E. coli by Regulating GadW and GadY Expression. Front. Microbiol. 2020 , 11 , 1078. [ Google Scholar ] [ CrossRef ]
• Schwarz, J.; Schumacher, K.; Brameyer, S.; Jung, K. Bacterial battle against acidity. FEMS Microbiol. Rev. 2022 , 46 , fuac037. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Tramonti, A.; Santis, F.D.; Pennacchietti, E.; Biase, D.D. The yhiM gene codes for an inner membrane protein involved in GABA export in Escherichia coli . AIMS Microbiol. 2017 , 3 , 71. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Iyer, R.; Williams, C.; Miller, C. Arginine-agmatine antiporter in extreme acid resistance in Escherichia coli . J. Bacteriol. 2003 , 185 , 6556–6561. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Richard, H.T.; Foster, J.W. Acid resistance in Escherichia coli . Adv. Appl. Microbiol. 2003 , 52 , 167–186. [ Google Scholar ]
• Fang, Y.; Kolmakova-Partensky, L.; Miller, C. A bacterial arginine-agmatine exchange transporter involved in extreme acid resistance. J. Biol. Chem. 2007 , 282 , 176–182. [ Google Scholar ] [ CrossRef ]
• Gong, S.; Ma, Z.; Foster, J.W. The Era-like GTPase TrmE conditionally activates gadE and glutamate-dependent acid resistance in Escherichia coli . Mol. Microbiol. 2004 , 54 , 948–961. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Bekhit, A.; Fukamachi, T.; Saito, H.; Kobayashi, H. The role of OmpC and OmpF in acidic resistance in Escherichia coli . Biol. Pharm. Bull. 2011 , 34 , 330–334. [ Google Scholar ] [ CrossRef ]
• Tsai, M.F.; Miller, C. An arginine-agmatine antiporter optimized for extreme acid resistance in enteric bacteria. Biophys. J. 2013 , 104 , 300a. [ Google Scholar ] [ CrossRef ]
• Moreau, P.L. The lysine decarboxylase CadA protects Escherichia coli starved of phosphate against fermentation acids. J. Bacteriol. 2007 , 189 , 2249–2261. [ Google Scholar ] [ CrossRef ]
• Neely, M.N.; Dell, C.L.; Olson, E.R. Roles of LysP and CadC in mediating the lysine requirement for acid induction of the Escherichia coli cad operon. J. Bacteriol. 1994 , 176 , 3278–3285. [ Google Scholar ] [ CrossRef ]
• Rauschmeier, M.; Schüppel, V.; Tetsch, L.; Jung, K. New insights into the interplay between the lysine transporter LysP and the pH sensor CadC in Escherichia coli . J. Mol. Biol. 2014 , 426 , 215–229. [ Google Scholar ] [ CrossRef ]
• Torres, A.G. The cad locus of Enterobacteriaceae: More than just lysine decarboxylation. Anaerobe 2009 , 15 , 1–6. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Guerra, P.R.; Herrero-Fresno, A.; Ladero, V.; Redruello, B.; Dos Santos, T.P.; Spiegelhauer, M.R.; Jelsbak, L.; Olsen, J.E. Putrescine biosynthesis and export genes are essential for normal growth of avian pathogenic Escherichia coli . BMC Microbiol. 2018 , 18 , 226. [ Google Scholar ] [ CrossRef ]
• Kashiwagi, K.; Suzuki, T.; Suzuki, F.; Furuchi, T.; Igarashi, K. Coexistence of the genes for putrescine transport protein and ornithine decarboxylase at 16 min on Escherichia coli chromosome. J. Biol. Chem. 1991 , 266 , 20922–20927. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Wiebe, M.A.; Brannon, J.R.; Steiner, B.D.; Bamidele, A.; Schrimpe-Rutledge, A.C.; Codreanu, S.G.; Sherrod, S.D.; Mclean, J.A.; Hadjifrangiskou, M. Serine deamination is a new acid tolerance mechanism observed in uropathogenic Escherichia coli . mBio 2022 , 13 , e02922–e02963. [ Google Scholar ] [ CrossRef ]
• Vilhena, C.; Kaganovitch, E.; Shin, J.Y.; Grünberger, A.; Behr, S.; Kristoficova, I.; Brameyer, S.; Kohlheyer, D.; Jung, K. A single-cell view of the BtsSR/YpdAB pyruvate sensing network in Escherichia coli and its biological relevance. J. Bacteriol. 2018 , 200 , 10–1128. [ Google Scholar ] [ CrossRef ]
• Xu, W.; Mukherjee, S.; Ning, Y.; Hsu, F.F.; Zhang, K. Cyclopropane fatty acid synthesis affects cell shape and acid resistance in Leishmania mexicana . Int. J. Parasitol. 2018 , 48 , 245–256. [ Google Scholar ] [ CrossRef ]
• Morè, N.; Martorana, A.M.; Biboy, J.; Otten, C.; Winkle, M.; Serrano, C.K.G.; Montón Silva, A.; Atkinson, L.; Yau, H.; Breukink, E. Peptidoglycan remodeling enables Escherichia coli to survive severe outer membrane assembly defect. mBio 2019 , 10 , e02729-18. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Yuan, J.; Jin, F.; Glatter, T.; Sourjik, V. Osmosensing by the bacterial PhoQ/PhoP two-component system. Proc. Natl. Acad. Sci. USA 2017 , 114 , E10792–E10798. [ Google Scholar ] [ CrossRef ]
• Chakraborty, S.; Winardhi, R.S.; Morgan, L.K.; Yan, J.; Kenney, L.J. Non-canonical activation of OmpR drives acid and osmotic stress responses in single bacterial cells. Nat. Commun. 2017 , 8 , 1587. [ Google Scholar ] [ CrossRef ]
• Sperandeo, P.; Martorana, A.M.; Polissi, A. Lipopolysaccharide biosynthesis and transport to the outer membrane of Gram-negative bacteria. In Bacterial Cell Walls and Membranes ; Subcellular Biochemistry; Springer: Berlin/Heidelberg, Germany, 2019; pp. 9–37. [ Google Scholar ]
• Dahl, J.U.; Koldewey, P.; Salmon, L.C.; Horowitz, S.; Bardwell, J.C.A.; Jakob, U. HdeB functions as an acid-protective chaperone in bacteria. J. Biol. Chem. 2015 , 290 , 65–75. [ Google Scholar ] [ CrossRef ]
• Foit, L.; George, J.S.; Zhang, B.W.; Brooks, C.L.; Bardwell, J.C.A. Chaperone activation by unfolding. Proc. Natl. Acad. Sci. USA 2013 , 110 , E1254–E1262. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Fu, X.; Wang, Y.; Shao, H.; Ma, J.; Song, X.; Zhang, M.; Chang, Z. DegP functions as a critical protease for bacterial acid resistance. FEBS J. 2018 , 285 , 3525–3538. [ Google Scholar ] [ CrossRef ]
• Huber, D.; Bukau, B. DegP: A Protein “Death Star”. Structure 2008 , 16 , 989–990. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Yang, J.; Zhang, J.; Zhu, Z.; Jiang, X.; Zheng, T.; Du, G. Revealing novel synergistic defense and acid tolerant performance of Escherichia coli in response to organic acid stimulation. Appl. Microbiol. Biotechnol. 2022 , 106 , 7577–7594. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Peters, K.; Kannan, S.; Rao, V.A.; Biboy, J.; Vollmer, W. The redundancy of peptidoglycan carboxypeptidases ensures robust cell shape maintenance in Escherichia coli . mBio 2016 , 7 , e00816–e00819. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Shayanfar, S.; Broumand, A.; Pillai, D.S. Acid stress induces differential accumulation of metabolites in Escherichia coli O26:H11. J. Appl. Microbiol. 2018 , 125 , 1911–1919. [ Google Scholar ] [ CrossRef ]
• Xu, J.; Guo, L.; Zhao, N.; Meng, X.; Zhang, J.; Wang, T.; Wei, X.; Fan, M. Response mechanisms to acid stress of acid-resistant bacteria and biotechnological applications in the food industry. Crit. Rev. Biotechnol. 2023 , 43 , 258–274. [ Google Scholar ] [ CrossRef ]
• Nudler, E. Transcription-coupled global genomic repair in E. coli . Trends Biochem. Sci. 2023 , 48 , 873–882. [ Google Scholar ] [ CrossRef ]
• Duprie, M. Recruitment and Function of Mlh1-Pms1 in DNA Mismatch Repair ; University of California: San Diego, CA, USA, 2020. [ Google Scholar ]
• Zhang, J.; Wang, S.; Abee, T.; Veen, S. Role of base excision repair in Listeria monocytogenes DNA stress survival during infections. J. Infect. Dis. 2021 , 223 , 721–734. [ Google Scholar ] [ CrossRef ]
• Payne-Dwyer, A.L.; Syeda, A.H.; Shepherd, J.W.; Frame, L.; Leake, M.C. RecA and RecB: Probing complexes of DNA repair proteins with mitomycin C in live Escherichia coli with single-molecule sensitivity. J. R. Soc. Interface 2022 , 19 , 20220437. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Mallick, S.; Das, S. Acid-tolerant bacteria and prospects in industrial and environmental applications. Appl. Microbiol. Biotechnol. 2023 , 107 , 3355–3374. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Yao, X.; Liu, P.; Chen, B.; Wang, X.; Tao, F.; Lin, Z.; Yang, X. Synthetic acid stress-tolerance modules improve growth robustness and lysine productivity of industrial Escherichia coli in fermentation at low pH. Microb. Cell Fact. 2022 , 21 , 68. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Yang, J.; Peng, Z.; Zhu, Q.; Zhang, J.; Du, G. [NiFe] Hydrogenase accessory proteins HypB–HypC accelerate proton conversion to enhance the acid resistance and D-lactic acid production of Escherichia coli . ACS Synth. Biol. 2022 , 11 , 1521–1530. [ Google Scholar ] [ CrossRef ]
• Tan, Z.; Yoon, J.M.; Nielsen, D.R.; Shanks, J.V.; Jarboe, L.R. Membrane engineering via trans unsaturated fatty acids production improves Escherichia coli robustness and production of biorenewables. Metab. Eng. 2016 , 35 , 105–113. [ Google Scholar ] [ CrossRef ]
• Hou, D.; O Connor, D.; Igalavithana, A.D.; Alessi, D.S.; Luo, J.; Tsang, D.C.W.; Sparks, D.L.; Yamauchi, Y.; Rinklebe, J.; Ok, Y.S. Metal contamination and bioremediation of agricultural soils for food safety and sustainability. Nat. Rev. Earth Environ. 2020 , 1 , 366–381. [ Google Scholar ] [ CrossRef ]
• Virpiranta, H.; Sotaniemi, V.; Leiviskä, T.; Taskila, S.; Rämö, J.; Johnson, D.B.; Tanskanen, J. Continuous removal of sulfate and metals from acidic mining-impacted waters at low temperature using a sulfate-reducing bacterial consortium. Chem. Eng. J. 2022 , 427 , 132050. [ Google Scholar ] [ CrossRef ]
• Diels, L.; De Smet, M.; Hooyberghs, L.; Corbisier, P. Heavy metals bioremediation of soil. Mol. Biotechnol. 1999 , 12 , 149–158. [ Google Scholar ] [ CrossRef ]
• Kang, S.H.; Singh, S.; Kim, J.; Lee, W.; Mulchandani, A.; Chen, W. Bacteria metabolically engineered for enhanced phytochelatin production and cadmium accumulation. Appl. Environ. Microbiol. 2007 , 73 , 6317–6320. [ Google Scholar ] [ CrossRef ]

Click here to enlarge figure

Share and Cite

Li, Z.; Huang, Z.; Gu, P. Response of Escherichia coli to Acid Stress: Mechanisms and Applications—A Narrative Review. Microorganisms 2024 , 12 , 1774. https://doi.org/10.3390/microorganisms12091774

Li Z, Huang Z, Gu P. Response of Escherichia coli to Acid Stress: Mechanisms and Applications—A Narrative Review. Microorganisms . 2024; 12(9):1774. https://doi.org/10.3390/microorganisms12091774

Li, Zepeng, Zhaosong Huang, and Pengfei Gu. 2024. "Response of Escherichia coli to Acid Stress: Mechanisms and Applications—A Narrative Review" Microorganisms 12, no. 9: 1774. https://doi.org/10.3390/microorganisms12091774

Article Metrics

Article access statistics, further information, mdpi initiatives, follow mdpi.

Subscribe to receive issue release notifications and newsletters from MDPI journals

• Bibliography
• More Referencing guides Blog Automated transliteration Relevant bibliographies by topics
• Automated transliteration
• Relevant bibliographies by topics
• Referencing guides

Tracing Back the Evolutionary Route of Enteroinvasive Escherichia coli (EIEC) and Shigella Through the Example of the Highly Pathogenic O96:H19 EIEC Clone

Valeria michelacci.

1 Department of Food Safety, Nutrition and Veterinary Public Health, Istituto Superiore di Sanità, Rome, Italy

Rosangela Tozzoli

Silvia arancia, alfio d'angelo, arianna boni, arnold knijn, gianni prosseda.

2 Department of Biology and Biotechnology “Charles Darwin”, Università Sapienza di Roma, Rome, Italy

David R. Greig

3 Gastrointestinal Bacteria Reference Unit (GBRU), Public Health England, E. coli, Shigella, Yersinia and Vibrio Reference Service, National Infection Service, London, United Kingdom

Claire Jenkins

Teresa camou.

4 Departamento de Laboratorios, Ministerio de Salud Pública, Montevideo, Uruguay

Alfredo Sirok

Armando navarro.

5 Public Health Department, Medicine Faculty, Universidad Nacional Autónoma de Mexico (UNAM), Mexico City, Mexico

Felipe Schelotto

6 Departamento de Bacteriología y Virología, Facultad de Medicina, Instituto de Higiene, Universidad de la República, Montevideo, Uruguay

Gustavo Varela

Stefano morabito, associated data.

The datasets generated and used for this study can be found in the EMBL-European Nucleotide Archive Study with Acc. No. PRJEB35723 and at NCBI Bioproject with Acc. No. PRJNA315192. All the details about the Acc. No. of each sequencing run and of additional samples included in the study are listed in Supplementary Table 1 .

Enteroinvasive Escherichia coli (EIEC) cause intestinal illness through the same pathogenic mechanism used by Shigella spp. The latter species can be typed through genomic and phenotypic methods used for E. coli and have been proposed for reclassification within E. coli species. Recently the first appearance of a highly pathogenic EIEC O96:H19 was described in Europe as the causative agent of two large outbreaks that occurred in Italy and in the United Kingdom. In contrast to Shigella spp and to the majority of EIEC strains, EIEC O96:H19 fermented lactose, lacked pathoadaptive mutations, and showed good fitness in extracellular environment, similarly to non-pathogenic E. coli , suggesting they have emerged following acquisition of the invasion plasmid by a non-pathogenic E. coli . Here we describe the whole genome comparison of two EIEC O96:H19 strains isolated from severe cases of diarrhea in Uruguay in 2014 with the sequences of EIEC O96:H19 available in the public domain. The phylogenetic comparison grouped all the O96:H19 strains in a single cluster, while reference EIEC strains branched into different clades with Shigella strains occupying apical positions. The comparison of the virulence plasmids showed the presence of a complete conjugation region in at least one O96:H19 EIEC. Reverse Transcriptase Real Time PCR experiments confirmed in this strain the expression of the pilin-encoding gene and conjugation experiments suggested its ability to mobilize an accessory plasmid in a recipient strain. Noteworthy, the tra region was comprised between two reversely oriented IS 600 elements, which were also found as remnants in another EIEC O96:H19 plasmid lacking the tra locus . We hypothesize that an IS-mediated recombination mechanism may have caused the loss of the conjugation region commonly observed in EIEC and Shigella virulence plasmids. The results of this study support the hypothesis of EIEC originating from non-pathogenic E. coli through the acquisition of the virulence plasmid via conjugation. Remarkably, this study showed the ability of a circulating EIEC strain to mobilize plasmids through conjugation, suggesting a mechanism for the emergence of novel EIEC clones.

Introduction

Enteroinvasive Escherichia coli (EIEC) cause disease in humans, characterized by abdominal cramps, bloody and mucous diarrhea (van den Beld and Reubsaet, 2012 ). EIEC are able to invade and multiply in the human colonic epithelial cells analogously to the mechanism used by Shigella spp (Nataro and Kaper, 1998 ; Lan et al., 2004 ), making it difficult to differentiate between the disease caused by the two microorganisms. The main virulence genes of EIEC and Shigella are harbored on a large virulence plasmid termed pINV. These include the mxi and spa genes encoding a type three secretion system (T3SS) as well as the ipaB, ipaC, ipaD , and icsA genes encoding effectors necessary to invade and disseminate into the host cells (Pasqua et al., 2017 ). The transmission of the infection occurs via the fecal-oral route and the incidence of EIEC and Shigella infections is higher in geographical areas where there is less or no access to safe drinking water, health services, or electricity. However, infection may also occur by the ingestion of contaminated food or water. During the last decade an increase in the number of cases of EIEC infections has been observed in Europe, with two large outbreaks, suspected to be linked to the consumption of contaminated food, occurred in Italy and in the United Kingdom between 2012 (Escher et al., 2014 ) and 2014 (Newitt et al., 2016 ). The strains responsible for both the outbreaks belonged to the O96:H19 serotype and sequence type 99 (ST-99), which had never been described as EIEC before 2012. A third isolate sharing the same characteristics was also identified as the cause of a sporadic case of EIEC infection occurred in Spain in 2013, confirming the circulation of such clone in Europe (Michelacci et al., 2016 ).

The genomic characterization of these three strains enabled the detection of an IncFII plasmid larger than 200 kbp, resembling the invasion plasmid of EIEC and Shigella and harboring the virulence genes essential for intracellular localization and spread, but in a genomic background different from that of reference EIEC and Shigella strains (Michelacci et al., 2016 ). This led to the hypothesis that O96:H19 EIEC clone might have emerged after the acquisition of the virulence plasmid by an E. coli with the phenotypic and biochemical properties of a commensal E. coli strain (Michelacci et al., 2016 ).

In the present study, we report the description of two O96:H19 EIEC strains isolated from two patients in Uruguay in 2014 and describe the genomic comparison of their chromosome and plasmids with those of the O96:H19 EIEC strains isolated in Europe. Our data support the hypothesis that this EIEC clone may have emerged and spread thanks to pINV mobilization through conjugation and provide evidence that at least one of the EIEC O96:H19 studied possessed a complete conjugation region in the pINV and displayed a functional plasmid mobilization machinery.

Materials and Methods

Bacterial strains and genomes.

Two EIEC strains from Uruguay were included in this study: the strains V48 and V73 were isolated from fecal samples of an 18 month-old girl with bloody diarrhea and of a 14 year-old girl with fever, vomiting, abdominal pain, bloody diarrhea and shock in April and October 2014, respectively. The latter strain was isolated form a case part of a foodborne outbreak and there was no epidemiological link between the two cases (Peirano et al., 2018 ).

Genomes of EIEC O96:H19 available in the public domain were included in the comparative analyses. These included those of strains EF432, 152661 and CNM-2113/13, isolated during EIEC outbreaks occurring in Italy (Escher et al., 2014 ; Michelacci et al., 2016 ) and the UK (Michelacci et al., 2016 ; Newitt et al., 2016 ) and from a sporadic case in Spain, respectively (Michelacci et al., 2016 ), and the genomes of four other EIEC O96:H19 strains described in a previous study on EIEC circulating in the United Kingdom (details in Supplementary Table 1 ) (Cowley et al., 2018 ). The presence of the ipaH genetic marker of EIEC and Shigella was confirmed by PCR (Luscher and Altwegg, 1994 ) or in silico in all the E. coli strains included in the study.

The E. coli K12 strain CSH26 Nal r (Sorensen et al., 2003 ), showing resistance to nalidixic acid and sensitivity to streptomycin and sulfamethoxazole, was used as recipient strain in conjugation experiments with donor EF432 strain.

Genomes from reference EIEC and Shigella strains as well as from EIEC strains recently described to circulate in the UK and belonging to different serotypes (Cowley et al., 2018 ) were retrieved from international databases and analyzed to give context to the phylogenetic comparison (details in Supplementary Table 1 ).

DNA Extraction and Sequencing

The total DNA of the strains V48, V73, and CNM-2113/13 was extracted from two ml of overnight bacterial cultures with the GRS Genomic DNA kit (GRISP, Porto, Portugal) and sequenced on an Ion Torrent S5 platform (Life Technologies, Carlsbad, USA). In detail, 400 bp fragments libraries were prepared by using the NEBNext® Fast DNA Fragmentation & Library Prep Set for Ion Torrent (New England Biolabs, Ipswich, Massachusetts, USA). The template preparation and sequencing run were performed with the ION 520/530 KIT-OT2 following the manufacturer's instructions for 400 bp DNA libraries on ION 530 chips.

The genome of the 152661 strain from the outbreak in the UK, already sequenced through Illumina technology for routine surveillance of E. coli and Shigella by Public Health England ( Supplementary Table 1 ), was re-sequenced using a MinION system (Oxford Nanopore Technologies Ltd, Oxford, UK), producing long reads, with the aim of closing the complete sequence of the chromosome and the plasmids harbored by this strain.

In detail, total genomic DNA of 152661 strain was extracted using the Wizard Genomic DNA Purification kit (Promega, Madison, WI, USA) with significant modifications from manufacturer's instructions including no vortexing steps, double incubation and elution times and pre-chilling of 70% ethanol and 99% isopropanol before use. Library preparation was performed using the SQK-RBK004 (rapid) library preparation kit (Oxford Nanopore Technologies Ltd, Oxford, UK) according to manufacturer's instructions. The sequencing library was loaded onto a FLO-MIN106 R9.4.1 flow cell and sequenced on the MinION for 24 h.

The sequencing data generated during this project has been uploaded to the EMBL-ENA sequence database in the study with accession number PRJEB35723 and at NCBI Bioproject with Acc. No. PRJNA315192 (details in Supplementary Table 1 ).

Bioinformatics Analysis

Basic analyses: trimming and assembly.

The bioinformatics analyses of Illumina and Ion Torrent data were performed through the ARIES instance of the Galaxy bioinformatics framework ( https://www.iss.it/site/aries ) as previously described (Michelacci et al., 2016 ). Briefly, FastQC was used for quality check and “FastQ Positional and Quality Trimming” (Cuccuru et al., 2014 ) for trimming the raw reads. The contigs were assembled from Illumina and Ion Torrent trimmed data using SPADES version 3.12.0 (Bankevich et al., 2012 ), followed by the tool “Filter SPAdes repeats” Galaxy Version 1.0.1 ( https://github.com/phac-nml/galaxy_tools/ ). Default parameters were applied in the two steps.

As for the sample 152661, the data deriving from Illumina and Nanopore sequencing platforms were integrated. In detail, data produced from the MinION in a raw FAST5 format was basecalled and de-multiplexed using Albacore V2.3.3 (Oxford Nanopore Technologies, ONT) and Deepbinner v0.2.0 (Wick et al., 2018 ) to obtain sample-specific files in FASTQ format. Run metrics were generated using Nanoplot v1.8.1 (De Coster et al., 2018 ). The barcode and y-adapter were trimmed and chimeric reads split using Porechop v0.2.4 1 . Finally, the trimmed reads were filtered using Filtlong v0.1.1 with the following parameters: min length = 1,000, keep percent = 90 and target bases = 550 Mbp, to generate ~100x coverage with the longest and highest quality reads 2 .

Trimmed ONT FASTQ files were assembled using Canu v1.7 (Koren et al., 2017 ) and the filtered ONT FASTQ files were assembled using both Unicycler v0.4.2 (Wick et al., 2017 ) with the following parameters: min_fasta_length=1000, mode=normal. The assembly showing the highest N50 and lowest number of contigs, with an assembly size comprised between 5.3 and 6.0 Mbp, were used for the following analyses. Polishing of the assemblies was performed in a three-step process, firstly using Nanopolish v0.11.1 (Loman et al., 2015 ) with both the trimmed ONT FASTQs and FAST5s files accounting for methylation using the –methylation-aware=dcm and –min-candidate-frequency=0.5.

Secondly, Pilon v1.22 (Walker et al., 2014 ) was applied with Illumina FASTQ reads (Acc. No. SRR4181492) as the query dataset with the use of BWA v0.7.17 (Li and Durbin, 2010 ) and Samtools v1.7 (Li et al., 2009 ). Finally, Racon v1.2.1 (Vaser et al., 2017 ) also using BWA v0.7.17 (Li and Durbin, 2010 ) and Samtools v1.7 (Li et al., 2009 ) was used with the Illumina reads for two cycles to produce a final assembly for each of the samples. The chromosome from the assembly was re-circularized and closed and re-orientated to start at the dnaA gene, as in the reference sequence of K12 E. coli MG1655 strain (Acc. No. NC_000913), using the –fixstart parameter in circlator v1.5.5 (Hunt et al., 2015 ).

The completely assembled sequence of 152661 resulting from this process was used as such for chromosome and plasmids comparison, strain characterization and phylogenetic analysis, as described later.

WGS Analysis for Strain Characterization, Chromosome, and Plasmids Comparison and Phylogenetic Analysis

The WGS analyses for strain characterization and typing were performed through ARIES webserver ( https://www.iss.it/site/aries ). Multi Locus Sequence Typing (MLST) was inferred from the trimmed Illumina and Ion Torrent reads using the SRST2 tool (Inouye et al., 2014 ) and applying the scheme developed by Wirth and colleagues (Wirth et al., 2006 ). The “ E. coli Serotyper” tool (Galaxy Version 1.1) was used with default parameters to interrogate the database of reference sequences for the determination of the serotypes (Joensen et al., 2015 ). The virulence genes typical of EIEC and Shigella were searched in the genome sequences as previously described Michelacci et al. ( 2016 ). Moreover, the assembled sequences of the EIEC O96:H19 strains were tested for the presence of virulence genes typical of other pathotypes of E. coli (Joensen et al., 2014 ) performing blastn analysis, using the threshold of minimum 90% of sequence identity and 80% of gene coverage.

The complete list of Accession Numbers of the sequences included in the comparison analysis is provided in Supplementary Table 1 .

The Prokka tool (Seemann, 2014 ) was used for the functional annotation of the assembled sequences, using the E. coli specific gene database. Blast Ring Image Generator (BRIG) software v0.95 (Alikhan et al., 2011 ) was used with default parameters to compare the completely assembled sequences of the chromosome and virulence plasmid of the EIEC strains from Italy (EF432) (Pettengill et al., 2015a ) used as reference sequences, with those of the other EIEC O96:H19 considered in this study. This analysis also included the completely assembled sequence of the largest plasmid of strain 152661 (Acc. No. CP046677).

The presence of pathoadaptive mutations in cadA, cadB, cadC, speG, nadA , and nadB was investigated and the sequences of speA, speB, speC, speD, speE , and speF genes verified as previously described (Michelacci et al., 2016 ) through the use of MAUVE software (suggested development snapshot 2015-02-26) (Rissman et al., 2009 ).

The detection of genetic elements involved in conjugation and the design of the maps of the closed plasmids were performed through the OriT Finder tool available online ( http://202.120.12.134/oriTfinder/oriTfinder.html ) with default parameters by uploading the annotated Genbank files produced with the Prokka software. MAUVE software (Rissman et al., 2009 ) was used for a deeper comparison of the conjugative regions in a set of plasmid sequences selected on the basis of the results of the BRIG analysis. The ISfinder webserver ( https://www-is.biotoul.fr ) (Siguier et al., 2006 ) was used to characterize and compare the insertion elements identified at the two sides of the conjugation region of pINV from strain EF432.

The core genome MLST (cgMLST) comparison was performed with the chewBBACA tool version 2.0.13 (Silva et al., 2018 ) with default parameters and used the database developed by EnteroBase ( https://enterobase.warwick.ac.uk/ ) and curated in the framework of INNUENDO project, comprising the analysis of 2360 loci (Llarena et al., 2018 ) to call the alleles. The Minimum Spanning Tree was generated by analyzing the allelic matrix on the PHYLOViZ online web-based tool (Ribeiro-Goncalves et al., 2016 ).

Analysis of the Expression of traA Pilin-Encoding Gene

RNA was extracted from one ml of overnight cultures of the strain EF432 grown at 30° and 37°C using the Norgen RNA/Protein Purification Kit (Norgen Biotek, Thorold, ON, Canada). In detail, 1 μg of extracted RNA was used for DNA removal and retro-transcription with the QuantiTect Reverse Transcription (Qiagen, Germantown, MD, USA). Two μl of the cDNA solutions were used in Real Time PCR reactions targeting traA gene, encoding the pilin, in 40 cycles of a two steps thermal profile (15 s at 95°C and 1 min at 55°C) using the following primers and probes: traA_FWD: AGTGATCCCGGTTGCTGTTT; traA_REV: GTACATGACTGCACCGACCA; traA_probe: CTTCTGCTGGTAAAGGCACG. The efficiency of the reaction was evaluated by using serial dilution (10 −1 ,10 −2 , 10 −3 , and 10 −4 ) of a 11.3 ng/μl DNA preparation purified from an overnight culture of EF432 strain as template in the same amplification run. The reactions were duplexed with reagents targeting gapA reference housekeeping gene, as previously described (Fitzmaurice et al., 2004 ). A negative control reaction was performed using non-retrotranscribed RNA. The efficiency, R 2 and M values of the traA gene amplification were compared to those of the reaction targeting gapA gene.

Bacterial Conjugation

Overnight cultures of donor strain EF432 and recipient strain CSH26 Nal r were diluted 1:10 in TSB and refreshed for 1.5 h. Two ml of each culture were mixed and incubated for 3 h at 37°C without shaking. The selective marker for the recipient strain was nalidixic acid, as EF432 was proved to be susceptible to its presence in growth media. As no selection markers were found on pINV, CongoRed was used as differential additive in combination with nalidixic acid, due to its ability to identify E. coli strains harboring pINV plasmid as red colonies (Maurelli et al., 1984 ). One hundred μl of undiluted conjugation mix and 10 −1 , 10 −2 , and 10 −3 serial dilutions were then plated and incubated at 37°C on two different media: CongoRed TSA plates supplied with 10 μg/ml of nalidixic acid and LB plates containing 10 μg/ml of nalidixic acid and 10 μg/ml of streptomycin. The colonies obtained on the latter were then streaked on LB plates containing 10 μg/ml of sulfamethoxazole for confirming the presence of the resistance plasmid of strain EF432.

Genomic Characterization of O96:H19 EIEC Strains Isolated From Uruguay

The genomic sequences of the V48 and V73 strains isolated in Uruguay were assembled in 141 and 139 contigs with N50 values of 113,473 and 103,437 bp, respectively. In silico typing confirmed the O96:H19 serotype and assigned to the strains the ST-99, the same Sequence Type identified in the already described O96:H19 EIEC (Michelacci et al., 2016 ). The virulence gene content and the presence of pathoadaptive mutations was investigated in the strains from Uruguay and compared to the same information obtained from the whole genome sequences of all the EIEC O96:H19 strains included in the study.

The results of the identification of the virulence genes typical of EIEC and Shigella are shown in Supplementary Table 2 . All the strains showed the same virulence gene asset already described for the O96:H19 isolated in Europe (Michelacci et al., 2016 ). A major exception was the strain identified with the Acc. No. SRR4786227 among the selected UK strains, which showed a peculiar asset of plasmid-borne virulence genes. In particular, the presence of the genes ipaH, ospG, virA , and virF and the absence of the region known as “entry region,” encoding the T3SS and its effectors were observed. On the other hand, the absence of ospG virulence gene was identified in two of these (Acc. No. SRR3578973 and SRR3578582), while in remaining one (Acc. No. SRR3578770) ospG gene was present, but the genes virA and icsA were lacking.

The detection of virulence genes of pathogenic E. coli other than EIEC allowed identifying the presence of lpfA and capU genes in all the O96:H19 strains. In particular, in the completely assembled sequences available of strains EF432 and 152661, lpfA gene was found on the chromosome while capU was detected in the virulence plasmid pINV.

The analysis of pathoadaptive mutations highlighted their absence in all the strains tested.

The comparison of the chromosomes of all the O96:H19 strains investigated is presented in Supplementary Figure 1 , and showed a similar structure in all the genomes investigated. Nevertheless, some short fragments resulted only present in the sequence of the completely assembled chromosomes of strains EF432 and 152661, mainly representing regions harboring prophages and encoding tRNAs and rRNAs. The complete list of these regions differentially present in the genomes, together with the encoded functions derived from annotation is presented in Supplementary Table 3 .

Comparison of the Invasion Plasmids

The comparison of the sequences of invasion plasmids showed the absence of the region comprising tra genes in four of the nine O96:H19 strains assayed. The same region was instead present in the sequence of the invasion plasmid of the EIEC O96:H19 strain EF432 isolated in Italy ( Figure 1 ). In detail, the sequences of pINV of the strains V48, V73, 152661 and that of the strain with the Acc. No. SRR4786227 completely lacked these genetic loci . Conversely, the strain from Spain CNM-2113/13 and three of the other isolates from the UK showed the presence of this locus , although apparently lacking some genetic fragments in the region ( Figure 1 ).

Comparison of invasion plasmids of O96:H19 EIEC strains. The completely assembled pINV from EF432 strain (inner circle, red color) responsible of the outbreak occurred in Italy in 2012 was used as reference for alignment and gene annotation.

Interestingly, a fragment longer than 30 kbp, corresponding to the “entry region” encoding the T3SS and its effectors, was absent from the plasmid of SRR4786227 strain, confirming the virulotyping results.

Mobilization Analysis of the Invasion Plasmids of O96:H19 EIEC Strains

In order to investigate the possibility to mobilize the pINV by the EIEC O96:H19 strain harboring the complete conjugative region, a detailed search of the presence of the genetic elements involved in conjugation was performed in the sequence of the plasmids of strain EF432. In addition, a transcription assay on pilin-encoding gene traA and a conjugation assay among EF432 and a recipient strain were also carried out.

Analysis of the Presence of Conjugation-Related Genetic Elements

The presence of genetic loci involved in plasmid transfer through conjugation was initially investigated on the closed sequences of the plasmids of strains EF432 and 152661 (Pettengill et al., 2015a ). The maps of pINV plasmids from the two strains are reported in Figures 2 , ​ ,3, 3 , while the maps of the accessory plasmids found in the same strains and harboring resistance genes (named pRES hereafter), are included as Supplementary Figures 2 , 3 . The complete list of the features involved in conjugation resulting from these analyses is reported in Table 1 , showing the presence of the complete asset of conjugation-related regions only on pINV plasmid from EF432 strain (pINV EF432 ). In particular, pINV from EF432 harbored genes encoding the relaxase and type IV coupling protein (T4CP), two essential components of the ssDNA conjugation machinery, and a region of about 41 kbp encoding the Type Four Secretion System (T4SS). The pRES plasmid harbored in the same strain, possessed part of the conjugative features but lacked the T4SS gene cluster ( Table 1 ). On the other hand, either the pINV or the pRES plasmids present in the strain 152661 lacked the origin of transfer ( oriT ), and the T4SS gene cluster region present on this pINV consisted of 16 kbp only ( Table 1 ). A deeper analysis showed the presence of two identical and inverted copies of a 1258 bp-long IS 600 element in the tra region (positions 72898- 74161 and 95672- 94409, Acc. No. CP011417) in pINV EF432 . The same region was lacking in pINV of 152661 (pINV 152661 ), but remnants of IS 600 elements (1121/1199 nucleotidic identity, 46 gaps) were found in the corresponding positions ( Figure 4 ).

Genetic map of the pINV virulence plasmid of EF432 strain obtained through OriT Finder. The annotation includes gene prediction obtained through Prokka (Seemann, 2014 ) or progressive numbers for the coding sequences identified for which no gene could be called.

Genetic map of the pINV virulence plasmid of 152661 strain obtained through OriT Finder. The annotation includes gene prediction obtained through Prokka (Seemann, 2014 ) or progressive numbers for the coding sequences identified for which no gene could be called.

Analysis of the presence of conjugation-related genetic elements in the closed sequences of the plasmids of the O96:H19 strains EF432 and 152661.

Alignment of tra regions in pINV of EF432 strain, used as reference, and pINV of 152661, produced with MAUVE tool (Rissman et al., 2009 ). Conserved segments that appear to be internally free from big genome rearrangements are visualized as colored blocks. A decrease in percentage of sequence identity is represented as a decrease in coloring. The genetic organization is represented under each sequence, with tra genes indicated with the corresponding letters ( traMJYAVCNQSDI ) and T4CP and Relaxase-encoding genes highlighted for their encoded function. The red boxes indicate the two identical and inverted copies of an IS 600 element in the reference, while the orange box highlights the IS 600 remnant in the corresponding region of pINV in 152661 strain.

The same analysis was performed to compare the tra region of pINV EF432 with those partially found in the pINV of other four isolates. The results, reported in Supplementary Figure 4 , showed a complete panel of tra genes only in the pINV of strain CNM-2113/13. The traD gene encoding the T4CP was instead absent from the remaining three plasmids. Additionally, the genes traN and traI were absent in the pINV sequence of strain SRR3578770. Finally, the presence of different short insertion elements in all the strains but CNM-2113/13 was observed ( Supplementary Figure 4 ).

Transcription Assay of Pilin-Encoding Gene traA in EF432 Strain

A reverse transcriptase Real Time PCR expression assay was deployed to verify the transcription of traA gene, encoding the main component of the conjugative pilus, present in pINV EF432 . The results showed that the traA gene was transcribed in both the growth conditions used (incubation at 30° and 37°C), even if at lower levels than the housekeeping gapA gene ( Table 2 ). The efficiency results of the reactions targeting traA and the housekeeping gene gapA , used as control, were comparable.

Results of the reverse transcription real time PCR expression assay for traA and gapA genes.

Conjugation Between Donor EF432 Strain and Recipient CSH26Nal E. coli K12 Strain

Conjugation experiments between donor strain EF432 and the recipient E. coli K12 strain CSH26 Nal r were performed to assess the ability of the strain EF432 to transfer one or both the pINV and pRES plasmids to the recipient strain. No red transconjugant colonies were identified on TSA plates supplemented with nalidixic acid and Congo Red. PCR screening for the presence of ipaH gene in a selection of 200 colonies also resulted negative. This was in line with the lack of red colonies observed, as the presence of pINV plasmid is associated with red color on plates containing Congo Red (Sakai et al., 1986 ). Nevertheless, when the conjugation mixture was plated on LB media supplemented with streptomycin, one colony was detected, which was proven to be also resistant to sulphametoxazole and negative to ipaH gene in PCR, resembling a trans-conjugative colony of CSH26 Nal r which got the accessory plasmid harboring the resistance genes to the two antimicrobials present in EF432 strain.

Phylogenetic Analysis of EIEC O96:H19 Strains in Comparison With Reference EIEC and Shigella Strains

A whole genome comparison of the population of EIEC O96:H19 genomes studied was performed using cgMLST. The strains included were the EIEC strains isolated in Uruguay and EIEC strains belonging to the serotype O96:H19, including those isolated in the outbreaks occurred in Italy and the UK, the strain isolated in Spain and isolates described in a previous study on EIEC strains isolated from UK residents (Cowley et al., 2018 ). Moreover, EIEC strains representative of all the serotypes detected during the same study (Cowley et al., 2018 ) were included in the analysis for comparative purposes, as well as the 4608 and 6.81 EIEC reference strains and genomes from different Shigella species ( Supplementary Table 1 ). The statistics of this analysis are reported in Supplementary Table 4 , while the minimum spanning tree is shown in Figure 5 . It is important to note that, with the only exception of the 6.81 reference EIEC strain whose published sequence showed the lowest quality, for all the other genomes alleles could be called for almost all the loci included in the cgMLST scheme used ( Supplementary Table 4 ). The figure shows colors based on the detected Sequence Type. The O96:H19 strains, all belonging to ST-99, formed a homogeneous cluster. Two separate branches, one comprising only EIEC strains belonging to ST-6 and the second including all the other STs comprising all the Shigella and EIEC reference strains, segregated far apart from each other in terms of allelic distances and from the cluster of O96:H19 strains. Noteworthy, all Shigella strains occupied terminal positions, branching from one single EIEC strain typed as O28ac:H7 and showing the highest number of allelic distances from O96:H19 cluster.

Phylogenomic analysis of EIEC and Shigella strains through cgMLST. For EIEC isolates, the strains identifiers include the strain name and the O and H antigens, each separated by underscores. For Shigella isolates, the strains identifiers comprise the species and the strain name. The different colors categorize the Sequence Types derived for the corresponding strains, as detailed in the legend. The numbers in red indicate the number of allelic differences identified for each link.

The acquisition of genetic elements through horizontal gene transfer represents a major genetic mechanism driving the radiation of pathogenic Escherichia coli into different groups. Besides, the loss of genetic functions that are not required or could even have an adverse effect on the life of the bacterial pathogen offers additional advantages to certain pathogenic E. coli populations. Among diarrheagenic E. coli , Enteroinvasive E. coli (EIEC) are able to invade and replicate into the epithelial cells in the colon of the human host, with the same mechanism exerted by Shigella spp. (Pasqua et al., 2017 ). The key genetic event characterizing the evolution of EIEC and Shigella consisted in the acquisition of the pINV virulence plasmid, which harbors the majority of genes involved in the invasion mechanism, in combination with the accumulation of pathoadaptive mutations in anti-virulence loci , which has been extensively demonstrated either in EIEC or Shigella strains (Pasqua et al., 2017 ).

A novel EIEC O96:H19, emerging in Europe as a foodborne pathogen associated with outbreaks and sporadic cases, showed peculiar characteristics, such as lactose fermentation, motility, and lack of pathoadaptive mutations (Michelacci et al., 2016 ).

In the present paper we investigated the hypothesis of the emergence of such clone following an event of acquisition of the pINV plasmid by a non-pathogenic E. coli and studied its ability to exchange genetic material via conjugation. Additionally, we describe the characterization of EIEC O96:H19 strains isolated from two severe cases of infections occurred in Uruguay in 2014 (Peirano et al., 2018 ). The isolates from South America showed the absence in their genomes of pathoadaptive mutations and of chromosomal virulence genes usually found in EIEC and Shigella , while showed the presence of gsp genes, encoding a Type 2 Secretion System, also described in non-pathogenic E. coli (Stathopoulos et al., 2000 ). After the first description of EIEC O96:H19 (Michelacci et al., 2016 ), the whole genome sequences of other EIEC strains isolated in the UK were made available, including several O96:H19 isolates (Cowley et al., 2018 ). Four of these latter genomes were included in the present work and their comparison with the genomes of the other EIEC strains studied allowed to observe in one strain (Acc. No. SRR4786227) the lack of the complete “entry region”of the pINV virulence plasmids of EIEC and Shigella , which usually harbors the ipa-mxi-spa locus (Pasqua et al., 2017 ) ( Figure 1 and Supplementary Table 2 ). The loss of such region had already been described in spontaneous avirulent isolates of Shigella flexnerii (Venkatesan et al., 2001 ). It is interesting to note that in both cases, the deletion also included the region encompassing virA and icsA genes, not physically linked to the “entry region,” but still pivotal for the pathogenesis of Shigella and EIEC. While it is not possible to determine if such regions were lost or had never been acquired, in another EIEC O96:H19 strain (Acc. No. SRR3578770) the region including virA and icsA was absent from the plasmid, in presence of a complete “entry region” ( Figure 1 and Supplementary Table 2 ). This finding provides the first evidence, to the best of our knowledge, that the two regions can be acquired or lost in separate events. Moreover, the absence of ospG observed in two strains (Acc. No. SRR3578973 and SRR3578582), proving instead positive either for the “entry region” or the virA-icsA region, appeared in contrast with the previous hypothesis of co-acquisition of these loci (Buchrieser et al., 2000 ). Even if it is not possible to exclude that the absence of ospG gene in one of the strains could derive from a specific deletion event, its presence in the other, lacking the “entry region” and the virA-icsA locus (SRR4786227), suggests instead that the acquisition of ospG locus could have derived from an independent acquisition event.

Despite the absence of some EIEC virulence genes in many of the O96:H19 strains isolated in UK, it should be considered that they were all isolated from hospitalized or community cases of gastrointestinal disease (Cowley et al., 2018 ). In this respect, the reported presence of multiple transposons and insertion elements in pINV plasmids of EIEC and Shigella (Pasqua et al., 2017 ), together with previous reports of spontaneous loss of the “entry region” from pINV plasmids resulting in avirulent strains (Venkatesan et al., 2001 ), suggest that the loss of such virulence region in SRR4786227 could have occurred during isolation and subculturing of the strain.

The presence of the two virulence genes capU and lpfA in the EIEC O96:H19 strains, encoding an hexosyltransferase of Enteroaggregative E coli and rarely identified in S. flexnerii strains (Fujiyama et al., 2008 ; Ikumapayi et al., 2017 ) and the main subunit of the long polar fimbriae, frequently present in Shiga-toxin producing E. coli (STEC) and rarely identified in EIEC (Toma et al., 2006 ), respectively, may not be enough to explain the association of the strain lacking the “entry region” with gastrointestinal illness. Nevertheless, the conserved presence of these two genes suggests a role for their products in the virulence of EIEC O96:H19. Their function in the specific context of EIEC pathogenesis would necessitate further investigation.

The comparison of the virulence plasmids of the EIEC O96:H19 strains carried out in this study also highlighted the presence of a complete conjugation region in pINV of EF432 and CNM-2113/13 strains and a nearly complete region in other strains analyzed (namely SRR3578973, SRR3578770, and SRR3578582) ( Figures 1 , ​ ,2, 2 , 4 and Supplementary Figure 4 ). This region is completely lacking in pINV from reference EIEC and Shigella strains (Pasqua et al., 2017 ). The production of the completely closed sequences of the chromosomes and the plasmids of the strains EF432 and 152661 allowed a deeper investigation of the region involved in conjugation both in the pINV and in the accessory plasmid harboring resistance genes (pRES) found in the two strains ( Figures 2 , ​ ,3, 3 , Supplementary Figures 2 , 3 and Table 1 ). This analysis confirmed the presence of the whole set of loci involved in conjugation only in pINV from the EF432 strain, supporting the hypothesis that this plasmid may be capable of transferring to other E. coli strains through conjugation. The observation of active transcription of the traA pilin-coding gene through Real Time PCR and the result of conjugation experiments suggesting the transfer of the accessory pRES plasmid to a recipient strain strengthened such a hypothesis. As a matter of fact, the pRES plasmid of EF432 carried the genes conferring resistance to streptomycin and sulfametoxazole, which could have both been transferred to the E. coli K12 CSH26 Nal r used as recipient in the conjugation experiments. On the other hand, the pRES of this strain was negative for the tra genes involved in conjugation and, as such, could have been moved by exploiting an in trans -encoded conjugation machinery, which was, in our system, harbored on the pINV EF432 . The lack of identification of CSH26 Nal r transconjugant strains which acquired the pINV EF432 could be explained by the very low conjugation frequency (<10 −7 ) previously reported for pINV plasmids of Shigella strains (Sansonetti et al., 1981 ), in association with the lack of a selective marker on pINV EF432 . Further work involving different strategies such as tagging the plasmid with the insertion of an antimicrobial resistance gene cassette would ease the recovery of transconjugant clones confirming its capacity of self-mobilization through conjugation.

Altogether, these results are strongly indicative of the presence of a functional conjugation system at least in one O96:H19 EIEC strain, EF432. A similar system could also be present in the genome of the strain CNM-2113/13. Unfortunately, the sequence of this strain was not available as a closed genome and the fragmented contigs did not allow to completely characterize the tra locus on the plasmid ( Supplementary Figure 4 ). The finding of the identification of two inverted copies of IS 600 , belonging to IS 3 family, at the two sides of the region of pINV EF432 encoding conjugative elements and the presence of remnants of a similar IS 600 sequence in the corresponding region of the pINV 152261 ( Figure 4 ) suggested that a recombination event between these two copies could have led to the deletion of the DNA stretch of about 23 kbp, resulting in a plasmid with a defective conjugation region in the latter strain. This mechanism could be part of the stabilization process of the pINV in EIEC O96:H19, resulting in progressive loss of conjugation ability, as reported for Shigella species (Johnson and Nolan, 2009 ). Nevertheless, the identification of other insertion elements and of inversions in the tra region of other O96:H19 strains analyzed suggests that multiple events could contribute to the inactivation of the locus and the resulting stabilization of the plasmid. Similarly, the observation of a mosaic virulence genes asset in the pINV of several EIEC O96:H19, together with a variable pattern in the presence of the conjugation region, supports the recent emergence of the EIEC O96:H19 clone and could be related with the activation of mobile genetic elements on the plasmid.

In order to visualize the phylogenetic relationships among the EIEC O96:H19 strains, an analysis was conducted using the core genome Multi Locus Sequence Typing, including reference EIEC and Shigella strains for comparison ( Figure 5 ). A low number of allelic differences was observed among the different EIEC O96:H19 strains, which confirmed their recent evolution. This was also supported by the low variability in the chromosome structure as observed in the whole genome comparison performed by BRIG analysis ( Supplementary Figure 1 ) and by the identification of prophages in the majority of the differing regions.

The apical positions occupied by all the Shigella strains in the minimum spanning tree, which shows these strains branching from typical EIEC strains belonging to Sequence Types 270, 279 and 280 ( Figure 5 ), support the reclassification of Shigella into the E. coli species (Pettengill et al., 2015b ) and are in line with the high specialization of such strains for living as intracellular pathogens. It is also interesting to note that all the EIEC strains belonging to ST-6 formed a separate branch, supporting the previous hypothesis of a separate evolution for this EIEC clone (Michelacci et al., 2016 ).

Altogether, the results of this study demonstrate that the circulation of the highly virulent O96:H19 EIEC clone is not restricted to Europe and provide evidences for its recent emergence showing still active evolution mechanisms.

Noteworthy, the retention by some of the O96:H19 EIEC strains of the genetic locus encoding a functional conjugation machinery adds strong evidence to the hypothesis of the emergence of novel EIEC clones through the acquisition of the pINV plasmid by commensal or environmental E. coli strains via conjugation. As a matter of fact, EIEC O96:H19 display, besides the presence of the pINV plasmid, good growing abilities and capacity of mobilization outside the cells (Michelacci et al., 2016 ).

It cannot be excluded that such a clone could have been circulating even before its first description during the 2012 outbreak (Escher et al., 2014 ), and that it remained undetected due to its peculiar characteristics. As a matter of fact, in routine diagnosis, the identification of EIEC and Shigella usually relies on the isolation of colonies lacking lactose fermentation, lysine decarboxylase activity and motility.

Notably, a foodborne outbreak caused by a novel O8:H19 EIEC clone was also reported in North Carolina in 2018, representing the first confirmed outbreak of EIEC infections in the United States in 47 years, and the first report of EIEC serotype O8:H19 (Herzig et al., 2019 ), confirming the importance of preparedness in the detection of the EIEC pathotype. Further work should be carried out to explore the possibility that other EIEC types, including the mentioned O8:H19, may possess hybrid characteristics encompassing the ability of striving outside a eukaryotic cell and the presence of pINV, thus demonstrating the evolutionary pathway connecting the E. coli genomic continuum and Shigella strains.

Data Availability Statement

Author contributions.

VM conceived the experimental design and drafted the manuscript. RT contributed in the scientific discussion and particularly in the design of the conjugation and Real Time PCR experiments. AD'A performed the bioinformatics analyses on ARIES webserver. SA and AB prepared and checked the bacterial cultures and performed the Real Time PCR experiments. AK installed the ARIES server for the bioinformatic analyses and installed the tools for the data analysis. GP contributed in the discussion and provided the CSH26Nal strain for conjugation. DG and CJ took care of the Nanopore sequencing and data analysis at PHE and provided the strain from the United Kingdom, TC, AS, AN, FS, and GV provided and characterized the strains from Uruguay (in detail TC and AS made the initial characterization. GV and FS made the complete identification, including detection of the ipaH gene. AN performed the serotyping of both isolates). SM contributed in the scientific discussion and thoroughly revised the manuscript. Finally, all the authors approved the manuscript to be published.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Acknowledgments

We wish to thank Dr. Marco Crescenzi, Fiorella Ciaffoni, and Manuela Marra from the ISS Core Facilities Technical-Scientific Service for the Next Generation Sequencing through the Ion Torrent S5 platform.

1 Porechop . https://github.com/rrwick/Porechop

2 Filtlong . https://github.com/rrwick/Filtlong

Funding. The Oxford Nanopore sequencing was supported by the National Institute for Health Research Health Protection Research Unit in Gastrointestinal Infections. CJ and DG are affiliated to the National Institute for Health Research Health Protection Research Unit (NIHR HPRU) in Gastrointestinal Infections at the University of Liverpool in partnership with PHE, in collaboration with the University of East Anglia, the University of Oxford and the Quadram Institute of Food Research. CJ and DG are based at PHE. The views expressed are those of the authors and not necessarily those of the National Health Service, the NIHR, the Department of Health or PHE.

Supplementary Material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcimb.2020.00260/full#supplementary-material

Supplementary Tables 1, 2, 3 and 4 include, respectively: the list of strains used in this study, with accession numbers; virulotyping results of O96:H19 EIEC strains; regions of difference identified among chromosomes of O96:H19 strains; and the statistics of cgMLST analysis.

Supplementary Figures 1, 2, 3 and 4 illustrate, respectively: BRIG alignment among chromosomes of O96:H19 strains; genetic map of pRES from EF432; genetic map of pRES from 152661; alignment of tra regions in pINV of EF432 and of the strains harboring at least a part of the region.

• Alikhan N. F., Petty N. K., Ben Zakour N. L., Beatson S. A. (2011). BLAST ring image generator (BRIG): simple prokaryote genome comparisons . BMC Genom . 12 :402. 10.1186/1471-2164-12402 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Bankevich A., Nurk S., Antipov D., Gurevich A. A., Dvorkin M., Kulikov A. S., et al.. (2012). SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing . J. Computat. Biol. 19 , 455–477. 10.1089/cmb.2012.0021 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Buchrieser C., Glaser P., Rusniok C., Nedjari H., D'Hauteville H., Kunst F., et al.. (2000). The virulence plasmid pWR100 and the repertoire of proteins secreted by the type III secretion apparatus of Shigella flexneri . Mol. Microbiol . 38 , 760–771. 10.1046/j.1365-2958.2000.02179.x [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Cowley L. A., Oresegun D. R., Chattaway M. A., Dallman T. J., Jenkins C. (2018). Phylogenetic comparison of enteroinvasive Escherichia coli isolated from cases of diarrhoeal disease in England, 2005–2016 . J. Med. Microbiol . 67 , 884–888. 10.1099/jmm.0.000739 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Cuccuru G., Orsini M., Pinna A., Sbardellati A., Soranzo N., Travaglione A., et al.. (2014). Orione, a web-based framework for NGS analysis in microbiology . Bioinformatics 30 , 1928–1929. 10.1093/bioinformatics/btu135 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• De Coster W., D'Hert S., Schultz D. T., Cruts M., Van Broeckhoven C. (2018). NanoPack: visualizing and processing long-read sequencing data . Bioinformatics 34 , 2666–2669. 10.1093/bioinformatics/bty149 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Escher M., Scavia G., Morabito S., Tozzoli R., Maugliani A., Cantoni S., et al.. (2014). A severe foodborne outbreak of diarrhoea linked to a canteen in Italy caused by enteroinvasive Escherichia coli, an uncommon agent . Epidemiol. Infect . 142 , 2559–2566. 10.1017/S0950268814000181 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Fitzmaurice J., Glennon M., Duffy G., Sheridan J. J., Carroll C., Maher M. (2004). Application of real-time PCR and RT-PCR assays for the detection and quantitation of VT 1 and VT 2 toxin genes in E. coli O157:H7 . Mol. Cell Probes . 18 , 123–32. 10.1016/j.mcp.2003.10.004 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Fujiyama R., Nishi J., Imuta N., Tokuda K., Manago K., Kawano Y. (2008). The shf gene of a Shigella flexneri homologue on the virulent plasmid pAA2 of enteroaggregative Escherichia coli 042 is required for firm biofilm formation . Curr Microbiol . 56 , 474–480. 10.1007/s00284-008-9115-y [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Herzig C. T. A., Fleischauer A. T., Lackey B., Lee N., Lawson T., Moore Z. S., et al.. (2019). Notes from the field: enteroinvasive Escherichia coli outbreak associated with a potluck party - North Carolina, June-July 2018 . MMWR Morb. Mortal. Wkly Rep . 68 , 183–184. 10.15585/mmwr.mm6807a5 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Hunt M., Silva N. D., Otto T. D., Parkhill J., Keane J. A., Harris S. R. (2015). Circlator: automated circularization of genome assemblies using long sequencing reads . Genome Biol . 16 :294. 10.1186/s13059-015-0849-0 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Ikumapayi U. N., Boisen N., Hossain M. J., Betts M., Lamin M., Saha D., et al.. (2017). Identification of subsets of enteroaggregative Escherichia coli associated with diarrheal disease among under 5 years of age children from Rural Gambia . Am. J. Trop Med. Hygiene 97 , 997–1004. 10.4269/ajtmh.16-0705 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Inouye M., Dashnow H., Raven L. A., Schultz M. B., Pope B. J., Tomita T., et al.. (2014). SRST2: rapid genomic surveillance for public health and hospital microbiology labs . Genome Med . 6 :90. 10.1186/s13073-014-0090-6 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Joensen K. G., Scheutz F., Lund O., Hasman H., Kaas R. S., Nielsen E. M., et al.. (2014). Real-time whole-genome sequencing for routine typing, surveillance, and outbreak detection of verotoxigenic Escherichia coli . J. Clin. Microbiol . 52 , 1501–1510. 10.1128/JCM.03617-13 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Joensen K. G., Tetzschner A. M., Iguchi A., Aarestrup F. M., Scheutz F. (2015). Rapid and easy in silico serotyping of escherichia coli isolates by use of whole-genome sequencing data . J. Clin. Microbiol . 53 , 2410–2426. 10.1128/JCM.00008-15 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Johnson T. J., Nolan L. K. (2009). Pathogenomics of the virulence plasmids of Escherichia coli . Microbiol. Mol. Biol. Rev . 73 , 750–774. 10.1128/MMBR.00015-09 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Koren S., Walenz B. P., Berlin K., Miller J. R., Bergman N. H., Phillippy A. M. (2017). Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation . Genome Res . 27 , 722–736. 10.1101/gr.215087.116 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Lan R., Alles M. C., Donohoe K., Martinez M. B., Reeves P. R. (2004). Molecular evolutionary relationships of enteroinvasive Escherichia coli and Shigella spp . Infect Immun . 72 , 5080–5088. 10.1128/IAI.72.9.5080-5088.2004 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Li H., Durbin R. (2010). Fast and accurate long-read alignment with burrows-wheeler transform . Bioinformatics 26 , 589–595. 10.1093/bioinformatics/btp698 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., et al. (2009). The sequence alignment/map format and SAMtools . Bioinformatics 25 , 2078–2079. 10.1093/bioinformatics/btp352 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Llarena A. K. R., Silva D. N., Halkilahti J., Machado M. P., Da Silva M. S. (2018). INNUENDO: a cross-sectoral platform for the integration ofgenomics in the surveillance of food-borne pathogens . External Sci. Rep . 15 :5123 10.2903/sp.efsa.2018.EN-1498 [ CrossRef ] [ Google Scholar ]
• Loman N. J., Quick J., Simpson J. T. (2015). A complete bacterial genome assembled de novo using only nanopore sequencing data . Nat. Methods 12 , 733–735. 10.1038/nmeth.3444 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Luscher D., Altwegg M. (1994). Detection of shigellae, enteroinvasive and enterotoxigenic Escherichia coli using the polymerase chain reaction (PCR) in patients returning from tropical countries . Mol. Cell Probes 8 , 285–290. 10.1006/mcpr.1994.1040 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Maurelli A. T., Blackmon B., Curtiss R., III. (1984). Loss of pigmentation in Shigella flexneri 2a is correlated with loss of virulence and virulence-associated plasmid . Infect. Immun. 43 , 397–401. 10.1128/IAI.43.1.397-401.1984 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Michelacci V., Prosseda G., Maugliani A., Tozzoli R., Sanchez S., Herrera-Leon S., et al.. (2016). Characterization of an emergent clone of enteroinvasive Escherichia coli circulating in Europe . Clin. Microbiolo. Infect . 22 :e11–9. 10.1016/j.cmi.2015.10.025 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Nataro J. P., Kaper J. B. (1998). Diarrheagenic Escherichia coli . Clin. Microbiol. Rev . 11 , 142–201. 10.1128/CMR.11.1.142 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Newitt S., MacGregor V., Robbins V., Bayliss L., Chattaway M. A., Dallman T., et al.. (2016). Two linked enteroinvasive Escherichia coli outbreaks, Nottingham, UK, June 2014 . Emerg. Infect. Dis . 22 , 1178–1184. 10.3201/eid2207.152080 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Pasqua M., Michelacci V., Di Martino M. L., Tozzoli R., Grossi M., Colonna B., et al.. (2017). The intriguing evolutionary journey of enteroinvasive E. coli (EIEC) toward pathogenicity . Front. Microbiol . 8 :2390. 10.3389/fmicb.2017.02390 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Peirano V., Bianco M. N., Navarro A., Schelotto F., Varela G. (2018). Diarrheagenic Escherichia coli associated with acute gastroenteritis in children from Soriano, Uruguay . Can. J. Infect. Dis. Med. Microbiol . 2018 :8387218. 10.1155/2018/8387218 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Pettengill E. A., Hoffmann M., Binet R., Roberts R. J., Payne J., Allard M., et al.. (2015a). Complete genome sequence of enteroinvasive Escherichia coli O96:H19 associated with a severe foodborne outbreak . Genome Announc . 3 :e00883–15. 10.1128/genomeA.00883-15 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Pettengill E. A., Pettengill J. B., Binet R. (2015b). Phylogenetic analyses of shigella and enteroinvasive escherichia coli for the identification of molecular epidemiological markers: whole-genome comparative analysis does not support distinct genera designation . Front. Microbiol . 6 :1573. 10.3389/fmicb.2015.01573 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Ribeiro-Goncalves B., Francisco A. P., Vaz C., Ramirez M., Carrico J. A. (2016). PHYLOViZ Online: web-based tool for visualization, phylogenetic inference, analysis and sharing of minimum spanning trees . Nucleic Acids Res . 44 , W246–W251. 10.1093/nar/gkw359 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Rissman A. I., Mau B., Biehl B. S., Darling A. E., Glasner J. D., Perna N. T. (2009). Reordering contigs of draft genomes using the Mauve aligner . Bioinformatics 25 , 2071–2073. 10.1093/bioinformatics/btp356 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Sakai T., Sasakawa C., Makino S., Kamata K., Yoshikawa M. (1986). Molecular cloning of a genetic determinant for Congo red binding ability which is essential for the virulence of Shigella flexneri . Infect. Immun . 51 , 476–482. 10.1128/IAI.51.2.476-482.1986 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Sansonetti P. J., Kopecko D. J., Formal S. B. (1981). Shigella sonnei plasmids: evidence that a large plasmid is necessary for virulence . Infect. Immun . 34 , 75–83. 10.1128/IAI.34.1.75-83.1981 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Seemann T. (2014). Prokka: rapid prokaryotic genome annotation . Bioinformatics 30 , 2068–2069. 10.1093/bioinformatics/btu153 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Siguier P., Perochon J., Lestrade L., Mahillon J., Chandler M. (2006). ISfinder: the reference centre for bacterial insertion sequences . Nucleic Acids Res . 34 :D32–6. 10.1093/nar/gkj014 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Silva M., Machado M. P., Silva D. N., Rossi M., Moran-Gilad J., Santos S., et al.. (2018). chewBBACA: a complete suite for gene-by-gene schema creation and strain identification . Microb Genom . 4 :e000166. 10.1101/173146 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Sorensen A. H., Hansen L. H., Johannesen E., Sorensen S. J. (2003). Conjugative plasmid conferring resistance to olaquindox . Antimicrob. Agents Chemother . 47 , 798–799. 10.1128/AAC.47.2.798-799.2003 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Stathopoulos C., Hendrixson D. R., Thanassi D. G., Hultgren S. J., St Geme J. W., Curtiss R., III. (2000). Secretion of virulence determinants by the general secretory pathway in gram-negative pathogens: an evolving story . Microbes Infect. 2 , 1061–1072. 10.1016/S1286-4579(00)01260-0 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Toma C., Higa N., Iyoda S., Rivas M., Iwanaga M. (2006). The long polar fimbriae genes identified in Shiga toxin-producing Escherichia coli are present in other diarrheagenic E. coli and in the standard E. coli collection of reference (ECOR) strains . Res. Microbiol . 157 , 153–161. 10.1016/j.resmic.2005.06.009 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• van den Beld M. J., Reubsaet F. A. (2012). Differentiation between Shigella, enteroinvasive Escherichia coli (EIEC) and noninvasive Escherichia coli . Eur. J. Clin. Microbiol. Infect. Dis . 31 , 899–904. 10.1007/s10096-011-1395-7 [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Vaser R., Sovic I., Nagarajan N., Sikic M. (2017). Fast and accurate de novo genome assembly from long uncorrected reads . Genome Res . 27 , 737–746. 10.1101/gr.214270.116 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Venkatesan M. M., Goldberg M. B., Rose D. J., Grotbeck E. J., Burland V., Blattner F. R. (2001). Complete DNA sequence and analysis of the large virulence plasmid of Shigella flexneri . Infect. Immun . 69 , 3271–3285. 10.1128/IAI.69.5.3271-3285.2001 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Walker B. J., Abeel T., Shea T., Priest M., Abouelliel A., Sakthikumar S., et al.. (2014). Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement . PLoS ONE 9 :e112963. 10.1371/journal.pone.0112963 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Wick R. R., Judd L. M., Gorrie C. L., Holt K. E. (2017). Unicycler: resolving bacterial genome assemblies from short and long sequencing reads . PLoS Comput. Biol . 13 :e1005595. 10.1371/journal.pcbi.1005595 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Wick R. R., Judd L. M., Holt K. E. (2018). Deepbinner: demultiplexing barcoded oxford nanopore reads with deep convolutional neural networks . PLoS Comput. Biol . 14 :e1006583. 10.1371/journal.pcbi.1006583 [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Wirth T., Falush D., Lan R., Colles F., Mensa P., Wieler L. H., et al.. (2006). Sex and virulence in Escherichia coli : an evolutionary perspective . Mol Microbiol . 60 , 1136–1151. 10.1111/j.1365-2958.2006.05172.x [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]